Transcript: Human NM_030981.3

Homo sapiens RAB1B, member RAS oncogene family (RAB1B), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
RAB1B (81876)
Length:
1901
CDS:
42..647

Additional Resources:

NCBI RefSeq record:
NM_030981.3
NBCI Gene record:
RAB1B (81876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030981.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047214 CACGTACACAGAGAGCTACAT pLKO.1 134 CDS 100% 4.950 6.930 N RAB1B n/a
2 TRCN0000299381 CACGTACACAGAGAGCTACAT pLKO_005 134 CDS 100% 4.950 6.930 N RAB1B n/a
3 TRCN0000381705 TATGCTGCACTGGGTTCTCTC pLKO_005 975 3UTR 100% 4.050 5.670 N RAB1B n/a
4 TRCN0000047217 TGCCAGCGAGAACGTCAATAA pLKO.1 368 CDS 100% 13.200 9.240 N RAB1B n/a
5 TRCN0000299459 TGCCAGCGAGAACGTCAATAA pLKO_005 368 CDS 100% 13.200 9.240 N RAB1B n/a
6 TRCN0000382357 ATGTCGAGCAGGCGTTCATGA pLKO_005 511 CDS 100% 4.950 3.465 N RAB1B n/a
7 TRCN0000047215 GACCATCACTTCCAGCTACTA pLKO.1 254 CDS 100% 4.950 3.465 N RAB1B n/a
8 TRCN0000299460 GACCATCACTTCCAGCTACTA pLKO_005 254 CDS 100% 4.950 3.465 N RAB1B n/a
9 TRCN0000381822 GGCACCTTCTCCAGATGATGT pLKO_005 676 3UTR 100% 4.950 3.465 N RAB1B n/a
10 TRCN0000047213 TCATGGCATCATCGTGGTGTA pLKO.1 284 CDS 100% 4.050 2.835 N RAB1B n/a
11 TRCN0000047216 CATCATCGTGGTGTATGACGT pLKO.1 290 CDS 100% 2.640 1.848 N RAB1B n/a
12 TRCN0000299382 CATCATCGTGGTGTATGACGT pLKO_005 290 CDS 100% 2.640 1.848 N RAB1B n/a
13 TRCN0000100821 GCCAAGAATGCCACCAATGTT pLKO.1 495 CDS 100% 5.625 3.938 N Rab1b n/a
14 TRCN0000302711 GCCAAGAATGCCACCAATGTT pLKO_005 495 CDS 100% 5.625 3.938 N Rab1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030981.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04261 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04261 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465917 TCTGCGTGGACTTTCAGGGTCAGA pLX_317 52.8% 100% 100% V5 n/a
4 ccsbBroadEn_01357 pDONR223 100% 74.9% 91.7% None (many diffs) n/a
5 ccsbBroad304_01357 pLX_304 0% 74.9% 91.7% V5 (many diffs) n/a
6 TRCN0000466775 CTTCGATGTAGACACAACAGCAAG pLX_317 62.2% 74.9% 91.7% V5 (many diffs) n/a
Download CSV