Transcript: Human NM_031220.4

Homo sapiens PITPNM family member 3 (PITPNM3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PITPNM3 (83394)
Length:
7149
CDS:
150..3074

Additional Resources:

NCBI RefSeq record:
NM_031220.4
NBCI Gene record:
PITPNM3 (83394)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031220.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029773 GAAGAACAACTCGCGCATGAT pLKO.1 2834 CDS 100% 4.950 3.960 N PITPNM3 n/a
2 TRCN0000029769 CTGAGGAATGTCACGGCTAAT pLKO.1 2034 CDS 100% 10.800 7.560 N PITPNM3 n/a
3 TRCN0000029770 CTTGGGCTACATGATCCTTTA pLKO.1 2468 CDS 100% 10.800 7.560 N PITPNM3 n/a
4 TRCN0000029771 GAGATGGCTGAAGGGAAGAAT pLKO.1 270 CDS 100% 5.625 3.938 N PITPNM3 n/a
5 TRCN0000029772 CTTCGATGTGTCCGACTTCTT pLKO.1 1322 CDS 100% 4.950 3.465 N PITPNM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031220.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09092 pDONR223 100% 99.8% 99.7% None 689A>G;806G>A;2430T>C n/a
2 ccsbBroad304_09092 pLX_304 0% 99.8% 99.7% V5 689A>G;806G>A;2430T>C n/a
3 TRCN0000474993 CGCCGCCATTTATAAATCCCCTAA pLX_317 10.1% 99.8% 99.7% V5 689A>G;806G>A;2430T>C n/a
Download CSV