Construct: ORF TRCN0000474993
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013608.1_s317c1
- Derived from:
- ccsbBroadEn_09092
- DNA Barcode:
- CGCCGCCATTTATAAATCCCCTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PITPNM3 (83394)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474993
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 83394 | PITPNM3 | PITPNM family member 3 | NM_031220.4 | 99.8% | 99.7% | 689A>G;806G>A;2430T>C |
| 2 | human | 83394 | PITPNM3 | PITPNM family member 3 | NM_001165966.2 | 96.2% | 96% | (many diffs) |
| 3 | human | 83394 | PITPNM3 | PITPNM family member 3 | XM_011524015.3 | 85.2% | 85.1% | (many diffs) |
| 4 | human | 83394 | PITPNM3 | PITPNM family member 3 | XM_011524016.3 | 81.2% | 78.2% | (many diffs) |
| 5 | human | 83394 | PITPNM3 | PITPNM family member 3 | XM_011524017.3 | 55.6% | 55.3% | (many diffs) |
| 6 | mouse | 327958 | Pitpnm3 | PITPNM family member 3 | NM_001024927.2 | 89.4% | 94.2% | (many diffs) |
| 7 | mouse | 327958 | Pitpnm3 | PITPNM family member 3 | XM_006533563.1 | 89.3% | 94.1% | (many diffs) |
| 8 | mouse | 327958 | Pitpnm3 | PITPNM family member 3 | NM_001081641.1 | 88% | 93% | (many diffs) |
| 9 | mouse | 327958 | Pitpnm3 | PITPNM family member 3 | XM_006533564.1 | 87.9% | 92.9% | (many diffs) |
| 10 | mouse | 327958 | Pitpnm3 | PITPNM family member 3 | XM_011249083.2 | 86.5% | 89.9% | (many diffs) |
| 11 | mouse | 327958 | Pitpnm3 | PITPNM family member 3 | XM_006533565.2 | 86.3% | 90.7% | (many diffs) |
| 12 | mouse | 327958 | Pitpnm3 | PITPNM family member 3 | XM_006533566.1 | 85.4% | 90.1% | (many diffs) |
| 13 | mouse | 327958 | Pitpnm3 | PITPNM family member 3 | XM_017314612.1 | 83.6% | 88.3% | (many diffs) |
| 14 | mouse | 327958 | Pitpnm3 | PITPNM family member 3 | XR_388480.2 | 70.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2991
- ORF length:
- 2922
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggccaaggcg ggccgtgcag gtggtcctcc cccgggcggc ggtgccccct 121 ggcaccttcg aaatgtcctc agtgactctg tggagagctc agatgatgaa ttctttgatg 181 ccagagagga gatggctgaa gggaagaatg ccatcctcat tgggatgagc cagtggaact 241 ccaatgacct cgtggagcag atcgagacca tggggaaact ggacgagcat caaggagaag 301 ggaccgcgcc gtgcacatcc agcatcctcc aggagaagca gcgagaactg taccgggttt 361 ccttgagaag acagaggttc ccagcccagg gaagcatcga gatccacgaa gacagcgagg 421 aaggctgccc gcagcgctcc tgcaagacac atgtcctcct gctggtcctg catgggggaa 481 acatcctgga cacgggtgcc ggggacccgt cctgcaaggc agccgacatc cacaccttca 541 gctccgtgct ggagaaggtc acacgagccc atttccctgc tgccctgggc cacatcctca 601 tcaagttcgt cccctgtcct gccatctgct ctgaggcttt ctcgcttgtc tctcacctga 661 acccctacag ccacgatgag ggctgcctca gcagcagcca ggaccacgtc cctctggccg 721 cccttcccct gttggccatc tcctccccgc agtaccggga tgctgtcgcc accgtcatcg 781 agcgagccaa ccaggtctac agagagttcc tgaagtcctc tgatgggatt ggcttcagtg 841 ggcaggtgtg tctcatcggg gactgtgtgg gggacctcct ggccttcgat gccatctgct 901 acagtgcggg gccctcaggg gacagccctg ccagcagcag ccggaagggg agcatcagca 961 gcacccagga caccccagtc gcggtggagg aagattgcag cctggccagc agcaagcgtc 1021 tcagcaaaag caacattgac atctccagtg ggttggagga tgaggagccc aagaggccgt 1081 tgccgcggaa acagagcgac tcctccacct atgactgcga ggccatcacc cagcaccatg 1141 ccttcctctc aagcatccac tccagcgtgc taaaggatga gtctgagacc ccggcggctg 1201 gggggccgca gctccctgag gtcagcctgg gccgctttga cttcgatgtg tccgacttct 1261 tcctcttcgg ctcgccactg ggcctggtcc tggccatgcg gaggacggtg ctgcctgggc 1321 tggacggctt ccaggtgcgt cctgcctgca gccaggtcta cagcttcttc cattgcgcag 1381 acccctctgc ctcacggctc gagccactgc tggagcccaa gttccacctg gtgccgcctg 1441 tcagcgtgcc tcgctaccag aggttcccac tgggcgatgg gcagtccctc ctcctcgctg 1501 atgccctaca cacccacagc cccctcttcc tggagggcag ctcccgggac agcccgccac 1561 ttctggatgc ccctgcctcg ccccctcagg cctcgaggtt ccagcgccca ggacggagga 1621 tgagcgaggg gagctcccac agcgagagct cggagtcctc ggacagcatg gcacccgtgg 1681 gtgcctcccg catcacagcc aagtggtggg gaagcaagag gatcgactat gccctgtact 1741 gccctgatgt cctcacggcc ttccccaccg tggccctgcc ccacctcttc cacgccagtt 1801 actgggagtc cacagacgtg gtggccttca tcctgagaca ggtaatgcgc tatgagagcg 1861 tgaacatcaa ggaaagcgcc cgcctggacc ctgcagcact gagtcctgcc aacccccggg 1921 agaagtggct tcgtaagcgg actcaggtca agctgaggaa tgtcacggct aatcaccggg 1981 ccaatgatgt gattgctgct gaagatggcc cccaggtcct ggtggggcgg ttcatgtacg 2041 ggcccctcga catggtggct ctgactggag agaaggtgga catcctagta atggcagagc 2101 catcctcagg ccgctgggta cacctggaca cagagatcac caacagcagt ggtcgcatca 2161 catacaatgt gccgcggccc cggcgcctgg gggttggtgt ctatcctgtg aagatggtcg 2221 tcaggggcga ccagacctgt gccatgagct acctcacggt gttgcccagg ggcatggagt 2281 gtgtagtgtt cagcattgat gggtccttcg cggccagcgt gtctatcatg ggaagcgacc 2341 ccaaggtccg gccgggtgca gtggatgttg tccggcactg gcaggacttg ggctacatga 2401 tcctttacat cacgggacgg ccggacatgc agaagcagcg ggtggtgtcg tggctgtccc 2461 agcacaactt cccacagggc atgatcttct tctccgacgg gctggtgcat gacccgctgc 2521 ggcagaaggc catcttcctg cgcaacctca tgcaggagtg cttcatcaaa atcagtgcgg 2581 cctatggctc cacgaaggac atctctgtct acagcgtgct gggcctgcct gcctcccaga 2641 tcttcattgt gggccggccc accaagaagt accaaaccca gtgccagttc ctgagcgagg 2701 gcTACGCCGC ACACCTGGCC GCGCTGGAGG CCAGCCACCG CTCACGCCCA AAGAAGAACA 2761 ACTCGCGCAT GATCCTGCGC AAGGGCAGCT TCGGGCTGCA CGCGCAGCCA GAGTTCCTGC 2821 GGAAGCGCAA CCACCTGCGC AGAACCATGT CAGTGCAGCA GCCCGACCCG CCCGCCGCCA 2881 ACCCCAAGCC CGAGCGGGCC CAGAGCCAGC CCGAGTCGGA CAAAGACCAC GAGCGGCCGC 2941 TGCCGGCGCT CAGCTGGGCG CGTGGGCCCC CCAAGTTCGA GTCGGTGCCC TTGCCAACTT 3001 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 3061 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 3121 CTTGTGGAAA GGACGACGCC GCCATTTATA AATCCCCTAA ACGCGTTAAG TCgacaatca 3181 acctctggat tacaaaattt gtgaaagatt