Transcript: Mouse NM_031392.2

Mus musculus WD repeat domain 6 (Wdr6), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Wdr6 (83669)
Length:
4169
CDS:
78..3455

Additional Resources:

NCBI RefSeq record:
NM_031392.2
NBCI Gene record:
Wdr6 (83669)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031392.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243482 ACCATAGTTCTCGCAAGTATT pLKO_005 3562 3UTR 100% 13.200 18.480 N Wdr6 n/a
2 TRCN0000243481 GACAATCGCTTTCGGTCTTAC pLKO_005 1236 CDS 100% 10.800 15.120 N Wdr6 n/a
3 TRCN0000198131 CCCTAGAATATGTACTCGGTT pLKO.1 3944 3UTR 100% 2.640 3.696 N Wdr6 n/a
4 TRCN0000243480 CCCATAGCTGTGGCGTCAATA pLKO_005 3022 CDS 100% 13.200 10.560 N Wdr6 n/a
5 TRCN0000257076 CCACTGGCAAGGCTATCTTTG pLKO_005 1489 CDS 100% 10.800 7.560 N Wdr6 n/a
6 TRCN0000243483 TGCCATGGTGGCTACCTATAC pLKO_005 1806 CDS 100% 10.800 7.560 N Wdr6 n/a
7 TRCN0000197381 CTTGAGGTTTACAACTGGTAT pLKO.1 3429 CDS 100% 4.950 3.465 N Wdr6 n/a
8 TRCN0000181632 GCCTTTACCTACCTGAAGGAT pLKO.1 2085 CDS 100% 3.000 2.100 N Wdr6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031392.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11609 pDONR223 100% 22.1% 22.4% None (many diffs) n/a
2 ccsbBroad304_11609 pLX_304 0% 22.1% 22.4% V5 (many diffs) n/a
3 TRCN0000480785 TAGCCACTCCTTATCTACCACACA pLX_317 37.7% 22.1% 22.4% V5 (many diffs) n/a
Download CSV