Transcript: Human NM_031431.4

Homo sapiens component of oligomeric golgi complex 3 (COG3), mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
COG3 (83548)
Length:
4555
CDS:
99..2585

Additional Resources:

NCBI RefSeq record:
NM_031431.4
NBCI Gene record:
COG3 (83548)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031431.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065232 CCCATATATTTGCTGAAGTTT pLKO.1 834 CDS 100% 5.625 7.875 N COG3 n/a
2 TRCN0000435413 GGAGCAGTGTGATGCTATATT pLKO_005 512 CDS 100% 15.000 12.000 N COG3 n/a
3 TRCN0000065228 GCCAAGTTAGATGATTGTATA pLKO.1 777 CDS 100% 13.200 10.560 N COG3 n/a
4 TRCN0000175082 GCCAAGTTAGATGATTGTATA pLKO.1 777 CDS 100% 13.200 10.560 N Cog3 n/a
5 TRCN0000418986 GGTGAATAGTGACGGATTTAT pLKO_005 746 CDS 100% 15.000 10.500 N COG3 n/a
6 TRCN0000416268 GTGATAACTGCCTCGTTTAAA pLKO_005 2807 3UTR 100% 15.000 10.500 N COG3 n/a
7 TRCN0000065231 CCTGAGATAAGAGAACATTAT pLKO.1 2124 CDS 100% 13.200 9.240 N COG3 n/a
8 TRCN0000425502 GACAAAGGTTTCAGCGTTAAA pLKO_005 2246 CDS 100% 13.200 9.240 N COG3 n/a
9 TRCN0000065229 GCCTGCATTCAGTCCTTACTT pLKO.1 1857 CDS 100% 5.625 3.938 N COG3 n/a
10 TRCN0000065230 CCCATTGAACTGACTTCAGTA pLKO.1 315 CDS 100% 4.950 3.465 N COG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031431.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12742 pDONR223 100% 53.4% 53.3% None (many diffs) n/a
2 ccsbBroad304_12742 pLX_304 0% 53.4% 53.3% V5 (many diffs) n/a
3 TRCN0000469829 GACATGATCCGTATTAACAAGGGA pLX_317 35.7% 53.4% 53.3% V5 (many diffs) n/a
Download CSV