Transcript: Human NM_031460.4

Homo sapiens potassium two pore domain channel subfamily K member 17 (KCNK17), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
KCNK17 (89822)
Length:
1524
CDS:
100..1098

Additional Resources:

NCBI RefSeq record:
NM_031460.4
NBCI Gene record:
KCNK17 (89822)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031460.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043857 GATGTCGTCCAAGCATACAAA pLKO.1 337 CDS 100% 5.625 7.875 N KCNK17 n/a
2 TRCN0000043856 CCCATGGGAATCATACAGCAT pLKO.1 1033 CDS 100% 2.640 2.112 N KCNK17 n/a
3 TRCN0000043854 CGACTACGTGATTGGAATGAA pLKO.1 774 CDS 100% 5.625 3.938 N KCNK17 n/a
4 TRCN0000043855 CGCCTCTTCTGCATCTTCTTT pLKO.1 487 CDS 100% 5.625 3.375 N KCNK17 n/a
5 TRCN0000043853 CCACAGCTCTAAGGAAGACTT pLKO.1 933 CDS 100% 4.950 2.970 N KCNK17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031460.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14331 pDONR223 100% 99.6% 98.7% None 8G>A;61A>G;992delA n/a
2 ccsbBroad304_14331 pLX_304 0% 99.6% 98.7% V5 (not translated due to frame shift) 8G>A;61A>G;992delA n/a
3 TRCN0000469578 AGCAGCATCACTATAGTGAGTGCT pLX_317 26.5% 99.6% 98.7% V5 (not translated due to frame shift) 8G>A;61A>G;992delA n/a
Download CSV