Transcript: Human NM_031473.4

Homo sapiens intraflagellar transport 81 (IFT81), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
IFT81 (28981)
Length:
3026
CDS:
527..1822

Additional Resources:

NCBI RefSeq record:
NM_031473.4
NBCI Gene record:
IFT81 (28981)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031473.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159456 GCATCTATCATTTCCCGTAAA pLKO.1 1568 CDS 100% 10.800 15.120 N IFT81 n/a
2 TRCN0000319322 GCATCTATCATTTCCCGTAAA pLKO_005 1568 CDS 100% 10.800 15.120 N IFT81 n/a
3 TRCN0000160682 CAAGGCAACTTCGAGTTGAAA pLKO.1 1152 CDS 100% 5.625 4.500 N IFT81 n/a
4 TRCN0000160264 CAGCTCATTAAGAGAGTTGAA pLKO.1 1076 CDS 100% 4.950 3.960 N IFT81 n/a
5 TRCN0000159740 GCCCTTTAGGAAGAACTATAA pLKO.1 571 CDS 100% 13.200 9.240 N IFT81 n/a
6 TRCN0000319320 GCCCTTTAGGAAGAACTATAA pLKO_005 571 CDS 100% 13.200 9.240 N IFT81 n/a
7 TRCN0000192134 GCACAACAGAAACAGGAACAA pLKO.1 1193 CDS 100% 4.950 3.465 N Ift81 n/a
8 TRCN0000163554 GCTGAGATTGACCCAAAGCAA pLKO.1 653 CDS 100% 3.000 2.100 N IFT81 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031473.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03054 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03054 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480355 CTTCTCTTCATGCTTACGGGAGCT pLX_317 29% 100% 100% V5 n/a
Download CSV