Transcript: Mouse NM_031842.2

Mus musculus SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 (Smarcd1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Smarcd1 (83797)
Length:
3153
CDS:
36..1583

Additional Resources:

NCBI RefSeq record:
NM_031842.2
NBCI Gene record:
Smarcd1 (83797)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_031842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092957 GAGATGTGAATGTACGGTGTA pLKO.1 862 CDS 100% 4.050 5.670 N Smarcd1 n/a
2 TRCN0000309300 GAGATGTGAATGTACGGTGTA pLKO_005 862 CDS 100% 4.050 5.670 N Smarcd1 n/a
3 TRCN0000092954 GCGAGAGTTCATGTTGAGCTT pLKO.1 1346 CDS 100% 2.640 3.696 N Smarcd1 n/a
4 TRCN0000331926 GCGAGAGTTCATGTTGAGCTT pLKO_005 1346 CDS 100% 2.640 3.696 N Smarcd1 n/a
5 TRCN0000157443 GTGCCGATACTTCTACTCCAA pLKO.1 1508 CDS 100% 2.640 3.696 N SMARCD1 n/a
6 TRCN0000092953 GCCTGAAATCAAACGGGTAAA pLKO.1 2407 3UTR 100% 10.800 8.640 N Smarcd1 n/a
7 TRCN0000309365 GCCTGAAATCAAACGGGTAAA pLKO_005 2407 3UTR 100% 10.800 8.640 N Smarcd1 n/a
8 TRCN0000311289 CAAGCACTGTGGCAGTATATT pLKO_005 984 CDS 100% 15.000 10.500 N Smarcd1 n/a
9 TRCN0000305378 GAAACTGGACCAGACTATTAT pLKO_005 500 CDS 100% 15.000 10.500 N Smarcd1 n/a
10 TRCN0000092955 CCTGGGAATCCGAAACACATA pLKO.1 1562 CDS 100% 4.950 3.465 N Smarcd1 n/a
11 TRCN0000092956 GCGGATGAAGTTCTCAGAGAT pLKO.1 1085 CDS 100% 4.950 3.465 N Smarcd1 n/a
12 TRCN0000156349 CCAGACAACCATCTGGTAGAA pLKO.1 786 CDS 100% 0.495 0.347 N SMARCD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01557 pDONR223 100% 93.2% 99.4% None (many diffs) n/a
2 ccsbBroad304_01557 pLX_304 0% 93.2% 99.4% V5 (many diffs) n/a
3 TRCN0000471633 AAGATACACTGCTCCTTTAGTTCA pLX_317 30.8% 93.2% 99.4% V5 (many diffs) n/a
Download CSV