Transcript: Human NM_031845.2

Homo sapiens microtubule associated protein 2 (MAP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
MAP2 (4133)
Length:
5377
CDS:
249..1664

Additional Resources:

NCBI RefSeq record:
NM_031845.2
NBCI Gene record:
MAP2 (4133)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031845.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427297 CAAAGTCTCTGACGGAGTAAC pLKO_005 755 CDS 100% 10.800 15.120 N MAP2 n/a
2 TRCN0000108235 CCCAAACTGTAGTAATTGTTA pLKO.1 1780 3UTR 100% 5.625 7.875 N MAP2 n/a
3 TRCN0000108239 CCACCTGAGATTAAGGATCAA pLKO.1 330 CDS 100% 4.950 3.960 N MAP2 n/a
4 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4728 3UTR 100% 4.950 2.475 Y KAAG1 n/a
5 TRCN0000072066 CTCAACATAAAGACCAGACAA pLKO.1 589 CDS 100% 4.950 3.465 N Rbmy n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031845.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06559 pDONR223 100% 84.1% 84.2% None 21T>C;516_517ins171;1005_1006ins93 n/a
2 ccsbBroad304_06559 pLX_304 0% 84.1% 84.2% V5 21T>C;516_517ins171;1005_1006ins93 n/a
3 TRCN0000478641 CGCTTCTGCGATGCTCAGGACAGG pLX_317 23% 84.1% 84.2% V5 21T>C;516_517ins171;1005_1006ins93 n/a
Download CSV