Transcript: Human NM_031852.1

Homo sapiens protocadherin alpha 7 (PCDHA7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PCDHA7 (56141)
Length:
2370
CDS:
1..2370

Additional Resources:

NCBI RefSeq record:
NM_031852.1
NBCI Gene record:
PCDHA7 (56141)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056095 AGGGCGCATGTAGTTTGGTAA pLKO.1 2186 CDS 100% 4.950 6.930 N PCDHA7 n/a
2 TRCN0000431516 AGGCTAAACATGGCAACTTCG pLKO_005 113 CDS 100% 4.050 5.670 N PCDHA7 n/a
3 TRCN0000056094 CATCACATTGATTAGCGTGTT pLKO.1 1104 CDS 100% 4.050 3.240 N PCDHA7 n/a
4 TRCN0000056093 GCCGACATCTACTGCTGTTTA pLKO.1 32 CDS 100% 13.200 9.240 N PCDHA7 n/a
5 TRCN0000056097 CTCCACAGTTGACTCTCACTT pLKO.1 1040 CDS 100% 4.950 3.465 N PCDHA7 n/a
6 TRCN0000437640 GTCTCTCCCTATTCCAGAGGA pLKO_005 1065 CDS 100% 2.640 1.848 N PCDHA7 n/a
7 TRCN0000415387 GGATCTTCTGGAGGTAAATCT pLKO_005 216 CDS 100% 5.625 3.375 N PCDHA7 n/a
8 TRCN0000414805 ACAGTTCTTGTGGAAGTTGTG pLKO_005 1003 CDS 100% 4.050 2.430 N PCDHA7 n/a
9 TRCN0000053274 CCAGTGATGTTTCTCCAGATA pLKO.1 845 CDS 100% 4.950 2.475 Y PCDHA9 n/a
10 TRCN0000053275 CTGGAGGTAAATCTGCAGAAT pLKO.1 223 CDS 100% 4.950 2.475 Y PCDHA9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02234 pDONR223 100% 74.3% 73.3% None (many diffs) n/a
2 ccsbBroad304_02234 pLX_304 0% 74.3% 73.3% V5 (many diffs) n/a
3 TRCN0000476214 CTTCGGTCTAAGTTTTCTGTTTTA pLX_317 12.4% 74.3% 73.3% V5 (many diffs) n/a
Download CSV