Transcript: Human NM_031856.1

Homo sapiens protocadherin alpha 8 (PCDHA8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
PCDHA8 (56140)
Length:
2445
CDS:
1..2445

Additional Resources:

NCBI RefSeq record:
NM_031856.1
NBCI Gene record:
PCDHA8 (56140)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031856.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426362 ACTGGTTGAGCTCGTATTAAG pLKO_005 570 CDS 100% 13.200 18.480 N PCDHA8 n/a
2 TRCN0000056022 CATGATTACTTCATGCTAGAT pLKO.1 523 CDS 100% 0.495 0.396 N PCDHA8 n/a
3 TRCN0000056021 GTGGAGGTGAAGGATGTTAAT pLKO.1 361 CDS 100% 13.200 9.240 N PCDHA8 n/a
4 TRCN0000427831 GAATGCCAGACTCTCGGTTTC pLKO_005 437 CDS 100% 6.000 4.200 N PCDHA8 n/a
5 TRCN0000056019 GCCTTGTTGAAACTATGGTTA pLKO.1 848 CDS 100% 4.950 3.465 N PCDHA8 n/a
6 TRCN0000056020 GTAGGCGAAGAGCAAGATTTA pLKO.1 2353 CDS 100% 13.200 7.920 N PCDHA8 n/a
7 TRCN0000436372 TAAGTCTGCAGAATGGCATTT pLKO_005 230 CDS 100% 10.800 6.480 N PCDHA8 n/a
8 TRCN0000056181 AGATCGAAATACGGGAGAAAT pLKO.1 885 CDS 100% 13.200 6.600 Y PCDHA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031856.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08631 pDONR223 100% 99.8% 99.6% None 233G>A;1251A>C;1735A>G n/a
2 ccsbBroad304_08631 pLX_304 0% 99.8% 99.6% V5 233G>A;1251A>C;1735A>G n/a
3 TRCN0000477948 TTCGGGTTGAACGATACGTTCCTT pLX_317 11.8% 99.8% 99.6% V5 233G>A;1251A>C;1735A>G n/a
4 ccsbBroadEn_10461 pDONR223 100% 77.3% 74.1% None (many diffs) n/a
5 ccsbBroad304_10461 pLX_304 0% 77.3% 74.1% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000491834 GGCGCATTCTGATCGATACCCATC pLX_317 13.2% 77.3% 74.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV