Transcript: Human NM_031861.2

Homo sapiens protocadherin alpha 11 (PCDHA11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PCDHA11 (56138)
Length:
4088
CDS:
1592..4024

Additional Resources:

NCBI RefSeq record:
NM_031861.2
NBCI Gene record:
PCDHA11 (56138)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055820 GCCCAATGGAAGACACTTATT pLKO.1 2446 CDS 100% 13.200 18.480 N PCDHA11 n/a
2 TRCN0000437215 ACCGAGACGAAGGAGTCAATG pLKO_005 2394 CDS 100% 10.800 15.120 N PCDHA11 n/a
3 TRCN0000055818 CGGAACTTAATTTGCTGCTAA pLKO.1 2208 CDS 100% 4.950 6.930 N PCDHA11 n/a
4 TRCN0000416409 TTGACCTACAGGCTAAGTAAA pLKO_005 2093 CDS 100% 13.200 10.560 N PCDHA11 n/a
5 TRCN0000412706 ACAAATGGTAAGCAGATTAAA pLKO_005 2141 CDS 100% 15.000 10.500 N PCDHA11 n/a
6 TRCN0000433958 CATACTCCTTAATGTCAATTA pLKO_005 2424 CDS 100% 13.200 9.240 N PCDHA11 n/a
7 TRCN0000055822 GTCTTCCTCTAGGTCTGAATA pLKO.1 3912 CDS 100% 13.200 9.240 N PCDHA11 n/a
8 TRCN0000055821 GCTGCTGATTGCGGAATCTAA pLKO.1 2008 CDS 100% 5.625 3.938 N PCDHA11 n/a
9 TRCN0000055819 CCAGAGTTTGATAAATCAGAA pLKO.1 2309 CDS 100% 4.950 3.465 N PCDHA11 n/a
10 TRCN0000053275 CTGGAGGTAAATCTGCAGAAT pLKO.1 1814 CDS 100% 4.950 2.475 Y PCDHA9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08630 pDONR223 100% 99.9% 100% None 1407A>G n/a
2 ccsbBroad304_08630 pLX_304 0% 99.9% 100% V5 1407A>G n/a
3 TRCN0000476743 TACCCAATACGCTCCCGGGGTTCT pLX_317 16.1% 99.9% 100% V5 1407A>G n/a
Download CSV