Transcript: Human NM_031898.3

Homo sapiens tektin 3 (TEKT3), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TEKT3 (64518)
Length:
1740
CDS:
144..1616

Additional Resources:

NCBI RefSeq record:
NM_031898.3
NBCI Gene record:
TEKT3 (64518)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116662 CGCCTGATTCAAGACAAATAT pLKO.1 519 CDS 100% 15.000 21.000 N TEKT3 n/a
2 TRCN0000414599 CTGACGGAAGTTGATACTATT pLKO_005 801 CDS 100% 13.200 18.480 N TEKT3 n/a
3 TRCN0000116665 CCGACATAATTCGGAGAAACT pLKO.1 482 CDS 100% 4.950 6.930 N TEKT3 n/a
4 TRCN0000116664 CGCTAAGCTAAGAGACGACAT pLKO.1 1097 CDS 100% 4.050 5.670 N TEKT3 n/a
5 TRCN0000414954 CACAGAGGGTGTCCGAGAATA pLKO_005 358 CDS 100% 13.200 9.240 N TEKT3 n/a
6 TRCN0000429067 GTAGCCCGAGAATGTCTATTT pLKO_005 723 CDS 100% 13.200 9.240 N TEKT3 n/a
7 TRCN0000116666 GCACTTACTGATGTGAAGAAA pLKO.1 660 CDS 100% 5.625 3.938 N TEKT3 n/a
8 TRCN0000116663 CCCACTCCAATTTGACCCATA pLKO.1 256 CDS 100% 4.050 2.835 N TEKT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031898.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08858 pDONR223 100% 99.7% 99.7% None 802G>A;1017A>G;1362A>C n/a
2 ccsbBroad304_08858 pLX_304 0% 99.7% 99.7% V5 802G>A;1017A>G;1362A>C n/a
3 TRCN0000472027 GAAAGTGATAGAGCAAGGCCTCGG pLX_317 33.2% 99.7% 99.7% V5 802G>A;1017A>G;1362A>C n/a
Download CSV