Transcript: Human NM_031904.5

Homo sapiens FERM domain containing 8 (FRMD8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
FRMD8 (83786)
Length:
3685
CDS:
126..1520

Additional Resources:

NCBI RefSeq record:
NM_031904.5
NBCI Gene record:
FRMD8 (83786)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031904.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180047 CGTCATCGATAGCAGAGAGAA pLKO.1 1031 CDS 100% 4.950 6.930 N FRMD8 n/a
2 TRCN0000244654 TCCTTTGCAGGCACGAGATAC pLKO_005 2219 3UTR 100% 10.800 7.560 N FRMD8 n/a
3 TRCN0000244655 CATTGAGTACTGCATCGAACT pLKO_005 1217 CDS 100% 4.050 2.430 N FRMD8 n/a
4 TRCN0000244656 ACAAGCTCCTCAAGATCTACT pLKO_005 1168 CDS 100% 4.950 2.475 Y FRMD8 n/a
5 TRCN0000244657 CTGACGTGCTGGTATACCTAG pLKO_005 214 CDS 100% 4.050 2.025 Y FRMD8 n/a
6 TRCN0000180759 GAAGGAACGTGTTCTTCCCAA pLKO.1 502 CDS 100% 2.640 1.320 Y FRMD8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031904.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14298 pDONR223 100% 99.8% 2.3% None 10delA;339C>T n/a
2 ccsbBroad304_14298 pLX_304 0% 99.8% 2.3% V5 (not translated due to prior stop codon) 10delA;339C>T n/a
3 TRCN0000469037 GAATGTTTCTGAAAGGGAGACTTC pLX_317 30.3% 99.8% 2.3% V5 (not translated due to prior stop codon) 10delA;339C>T n/a
4 ccsbBroadEn_10263 pDONR223 100% 76% 74.5% None (many diffs) n/a
5 ccsbBroad304_10263 pLX_304 0% 76% 74.5% V5 (many diffs) n/a
6 TRCN0000492107 CCGCAATGGTCACGCTTGATCTTA pLX_317 30.3% 76% 74.5% V5 (many diffs) n/a
7 ccsbBroadEn_16024 pDONR223 0% 10.9% 7% None (many diffs) n/a
8 ccsbBroad304_16024 pLX_304 0% 10.9% 7% V5 (many diffs) n/a
9 TRCN0000481224 CATATTGACATCGGATGTGTTTTA pLX_317 100% 10.8% 7% V5 (many diffs) n/a
Download CSV