Transcript: Human NM_032028.4

Homo sapiens testis specific serine kinase 1B (TSSK1B), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
TSSK1B (83942)
Length:
2437
CDS:
151..1254

Additional Resources:

NCBI RefSeq record:
NM_032028.4
NBCI Gene record:
TSSK1B (83942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032028.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219668 CAGTGGTCGAATGGCATTAAG pLKO.1 645 CDS 100% 13.200 18.480 N TSSK1B n/a
2 TRCN0000195563 CCGCAGACTTCTTGGAGAAAT pLKO.1 296 CDS 100% 13.200 9.240 N TSSK1B n/a
3 TRCN0000219667 TTGAGATTCTGGCCATGTTAA pLKO.1 332 CDS 100% 13.200 9.240 N TSSK1B n/a
4 TRCN0000037465 CTACGACGACTCCAACATCAA pLKO.1 795 CDS 100% 4.950 3.465 N TSSK1B n/a
5 TRCN0000037464 GTAGCATGGCAACTGGAGAAA pLKO.1 1952 3UTR 100% 4.950 3.465 N TSSK1B n/a
6 TRCN0000194927 CATTAAGCTTTAAAGTGCTAG pLKO.1 1879 3UTR 100% 4.050 2.835 N TSSK1B n/a
7 TRCN0000037467 TGCTCCATCATTAAGACCTAC pLKO.1 358 CDS 100% 4.050 2.835 N TSSK1B n/a
8 TRCN0000037466 TGGCAAGGTCTACATCGTCAT pLKO.1 399 CDS 100% 4.050 2.835 N TSSK1B n/a
9 TRCN0000037468 ACTGCTCCATCATTAAGACCT pLKO.1 356 CDS 100% 2.640 1.848 N TSSK1B n/a
10 TRCN0000199177 CCTAGGTGGATGAGGCCAAAG pLKO.1 1423 3UTR 100% 2.000 1.400 N TSSK1B n/a
11 TRCN0000379890 CAAGATCATCGACCGCAAGAA pLKO_005 270 CDS 100% 4.950 2.475 Y TSSK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032028.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09137 pDONR223 100% 99.9% 100% None 1098C>A n/a
2 ccsbBroad304_09137 pLX_304 0% 99.9% 100% V5 1098C>A n/a
3 TRCN0000467248 TACCCGACAGTCGCGCTCAACCGT pLX_317 41.6% 99.9% 100% V5 1098C>A n/a
4 ccsbBroadEn_15187 pDONR223 0% 99.9% 100% None 1098C>A n/a
5 ccsbBroad304_15187 pLX_304 0% 99.9% 100% V5 1098C>A n/a
6 TRCN0000479617 GTGCTGCCACTGCCTGAGCTACTG pLX_317 27.9% 99.9% 100% V5 1098C>A n/a
7 TRCN0000488681 CAAAGCTTGCTTCCCTCTCTTCAA pLX_317 27.9% 99.8% 99.4% V5 (not translated due to prior stop codon) 101T>C;1043C>A n/a
8 TRCN0000488714 CATTTGAGTGAGCTTGGATATAAG pLX_317 27.9% 99.8% 99.7% V5 (not translated due to prior stop codon) 101T>C;1098C>A n/a
9 TRCN0000491469 AGATAATCAGCCCTTGTGCGTCCT pLX_317 27.7% 99.8% 99.7% V5 1098C>A;1101_1102insG n/a
Download CSV