Transcript: Human NM_032089.1

Homo sapiens protocadherin gamma subfamily A, 9 (PCDHGA9), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PCDHGA9 (56107)
Length:
2487
CDS:
1..2487

Additional Resources:

NCBI RefSeq record:
NM_032089.1
NBCI Gene record:
PCDHGA9 (56107)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053406 CAACGGATTTACCGAGTTAAA pLKO.1 730 CDS 100% 13.200 18.480 N PCDHGA9 n/a
2 TRCN0000053404 GCGGAAGATTAGTCCTGCTAT pLKO.1 29 CDS 100% 4.950 6.930 N PCDHGA9 n/a
3 TRCN0000053403 CCCAAATTCTTGACCGAGAAA pLKO.1 1220 CDS 100% 4.950 3.465 N PCDHGA9 n/a
4 TRCN0000053407 CCTGCAAGTGACTGACATCAA pLKO.1 1317 CDS 100% 4.950 3.465 N PCDHGA9 n/a
5 TRCN0000053405 GCAATGAGAATTCTAGAGTTA pLKO.1 1442 CDS 100% 0.000 0.000 N PCDHGA9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03701 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03701 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465983 CACGGGCCCGTCCGTGATTTCTTT pLX_317 14.1% 100% 100% V5 n/a
Download CSV