Transcript: Human NM_032097.3

Homo sapiens protocadherin gamma subfamily B, 3 (PCDHGB3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PCDHGB3 (56102)
Length:
2598
CDS:
154..2598

Additional Resources:

NCBI RefSeq record:
NM_032097.3
NBCI Gene record:
PCDHGB3 (56102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032097.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439810 CGCTGGCTCCTCCGTATTAAA pLKO_005 921 CDS 100% 15.000 21.000 N PCDHGB3 n/a
2 TRCN0000438318 GAACCGATCCGCTACGCTATT pLKO_005 244 CDS 100% 10.800 15.120 N PCDHGB3 n/a
3 TRCN0000056393 GCCTTCTAATTCAGGCAATTT pLKO.1 2541 CDS 100% 13.200 9.240 N PCDHGB3 n/a
4 TRCN0000439927 ACCGTCATGCTGCACCTAATC pLKO_005 2122 CDS 100% 10.800 7.560 N PCDHGB3 n/a
5 TRCN0000056397 CGTGTGTTCTGGAATTTGAAA pLKO.1 455 CDS 100% 5.625 3.938 N PCDHGB3 n/a
6 TRCN0000056396 GCGGGTTATTGCAGAGAAGAA pLKO.1 351 CDS 100% 4.950 3.465 N PCDHGB3 n/a
7 TRCN0000056394 CCCAGTATTTACTCAGGACAT pLKO.1 870 CDS 100% 4.050 2.835 N PCDHGB3 n/a
8 TRCN0000056395 CCCAGAATACAATGTGACGAT pLKO.1 1398 CDS 100% 2.640 1.848 N PCDHGB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032097.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08619 pDONR223 100% 86.5% 86.2% None (many diffs) n/a
2 ccsbBroad304_08619 pLX_304 0% 86.5% 86.2% V5 (many diffs) n/a
3 TRCN0000475687 CCGTTATCTACAGATAATCAAGTC pLX_317 12.4% 86.5% 86.2% V5 (many diffs) n/a
Download CSV