Transcript: Human NM_032148.5

Homo sapiens solute carrier family 41 member 2 (SLC41A2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
SLC41A2 (84102)
Length:
4851
CDS:
531..2252

Additional Resources:

NCBI RefSeq record:
NM_032148.5
NBCI Gene record:
SLC41A2 (84102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032148.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043948 GCGCTGTGTTACAGGTATTTA pLKO.1 2053 CDS 100% 15.000 21.000 N SLC41A2 n/a
2 TRCN0000422258 AGATTGGACTTTACGTTTAAA pLKO_005 602 CDS 100% 15.000 10.500 N SLC41A2 n/a
3 TRCN0000420325 TAATGGTATTGGTGGTAATTT pLKO_005 1781 CDS 100% 15.000 10.500 N SLC41A2 n/a
4 TRCN0000420283 CATTTGGCAAGATGGATTATC pLKO_005 719 CDS 100% 13.200 9.240 N SLC41A2 n/a
5 TRCN0000043950 CCAGGAGAATTGCCTGATGAA pLKO.1 1854 CDS 100% 4.950 3.465 N SLC41A2 n/a
6 TRCN0000043949 CCTGCACTTCTTGGTCTCAAA pLKO.1 1131 CDS 100% 4.950 3.465 N SLC41A2 n/a
7 TRCN0000043951 GCCATGTTACAAGATGAAGAT pLKO.1 912 CDS 100% 4.950 3.465 N SLC41A2 n/a
8 TRCN0000174386 CTACCTCCATTTACATAGCAT pLKO.1 1832 CDS 100% 3.000 2.100 N Slc41a2 n/a
9 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 3262 3UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032148.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14304 pDONR223 100% 85.4% 85.1% None 1_249del;1712delT n/a
2 ccsbBroad304_14304 pLX_304 0% 85.4% 85.1% V5 (not translated due to frame shift) 1_249del;1712delT n/a
3 TRCN0000473433 ATGACGGTTCTCGCTTTCACACCC pLX_317 27.9% 85.4% 85.1% V5 (not translated due to frame shift) 1_249del;1712delT n/a
Download CSV