Transcript: Human NM_032182.4

Homo sapiens abraxas 2, BRISC complex subunit (ABRAXAS2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ABRAXAS2 (23172)
Length:
2955
CDS:
12..1259

Additional Resources:

NCBI RefSeq record:
NM_032182.4
NBCI Gene record:
ABRAXAS2 (23172)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032182.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330926 GGGCGATTTATCAGGTTTATA pLKO_005 631 CDS 100% 15.000 21.000 N ABRAXAS2 n/a
2 TRCN0000135173 CAGAGGATATCACTCGCTATT pLKO.1 477 CDS 100% 10.800 15.120 N ABRAXAS2 n/a
3 TRCN0000330848 CAGAGGATATCACTCGCTATT pLKO_005 477 CDS 100% 10.800 15.120 N ABRAXAS2 n/a
4 TRCN0000135550 GAAAGACATCAGGGCGATTTA pLKO.1 620 CDS 100% 13.200 10.560 N ABRAXAS2 n/a
5 TRCN0000330925 TGGTGCGATTCATGGATATAC pLKO_005 1489 3UTR 100% 13.200 9.240 N ABRAXAS2 n/a
6 TRCN0000133846 CAGAGCCTTCTAATAGTGAAT pLKO.1 1162 CDS 100% 4.950 3.465 N ABRAXAS2 n/a
7 TRCN0000330924 CAGAGCCTTCTAATAGTGAAT pLKO_005 1162 CDS 100% 4.950 3.465 N ABRAXAS2 n/a
8 TRCN0000135718 GCATGGAAAGGAGTGTCTTTA pLKO.1 982 CDS 100% 13.200 7.920 N ABRAXAS2 n/a
9 TRCN0000330849 GCATGGAAAGGAGTGTCTTTA pLKO_005 982 CDS 100% 13.200 7.920 N ABRAXAS2 n/a
10 TRCN0000135445 GCAGCCTTCAAAGAACTTCTT pLKO.1 1680 3UTR 100% 4.950 2.970 N ABRAXAS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032182.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11687 pDONR223 100% 74.9% 74.9% None 1_312del n/a
2 ccsbBroad304_11687 pLX_304 0% 74.9% 74.9% V5 1_312del n/a
3 TRCN0000467033 TATCTGGGCGCTCCACACCTACCC pLX_317 31.1% 74.9% 74.9% V5 1_312del n/a
Download CSV