Transcript: Human NM_032279.4

Homo sapiens ATPase 13A4 (ATP13A4), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ATP13A4 (84239)
Length:
7372
CDS:
97..3687

Additional Resources:

NCBI RefSeq record:
NM_032279.4
NBCI Gene record:
ATP13A4 (84239)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032279.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165824 GCAGCCTACTGCCAAAGATAT pLKO.1 2519 CDS 100% 13.200 18.480 N ATP13A4 n/a
2 TRCN0000165065 GCCGGATCCATCTTCTCATTT pLKO.1 205 CDS 100% 13.200 18.480 N ATP13A4 n/a
3 TRCN0000160049 CCTCATCAGCATCTATATCTT pLKO.1 2348 CDS 100% 5.625 7.875 N ATP13A4 n/a
4 TRCN0000161248 GAGGTTAATATGTGGGCCTAA pLKO.1 630 CDS 100% 4.050 5.670 N ATP13A4 n/a
5 TRCN0000159375 GTATATGATCTCAGAGAGCAA pLKO.1 817 CDS 100% 2.640 3.696 N ATP13A4 n/a
6 TRCN0000165242 GCCCTTGACGTCATCACAATT pLKO.1 1396 CDS 100% 13.200 10.560 N ATP13A4 n/a
7 TRCN0000220058 CTTGGCTTCTGAAGGTATTAG pLKO.1 3885 3UTR 100% 13.200 9.240 N ATP13A4 n/a
8 TRCN0000161566 GCTCATCAAGGAGGTTCTAAA pLKO.1 687 CDS 100% 13.200 9.240 N ATP13A4 n/a
9 TRCN0000220059 GTATACTCACGGAGTTGTAAT pLKO.1 4053 3UTR 100% 13.200 9.240 N ATP13A4 n/a
10 TRCN0000166421 CTCTACCCTAAGCCAGTGAAT pLKO.1 1249 CDS 100% 4.950 2.970 N ATP13A4 n/a
11 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 6600 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032279.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14308 pDONR223 100% 70.1% 33.4% None 1202_1203insA;1208_1209insG;2520_3588delinsG n/a
2 ccsbBroad304_14308 pLX_304 0% 70.1% 33.4% V5 (not translated due to prior stop codon) 1202_1203insA;1208_1209insG;2520_3588delinsG n/a
3 TRCN0000477341 GCCTGCTTTTAAACAATCATGTAG pLX_317 13.4% 70.1% 33.4% V5 (not translated due to prior stop codon) 1202_1203insA;1208_1209insG;2520_3588delinsG n/a
Download CSV