Transcript: Human NM_032331.3

Homo sapiens EEF1A lysine methyltransferase 4 (EEF1AKMT4), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
EEF1AKMT4 (110599564)
Length:
1027
CDS:
39..806

Additional Resources:

NCBI RefSeq record:
NM_032331.3
NBCI Gene record:
EEF1AKMT4 (110599564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032331.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158132 CGGTTTCCACTTCCATCTCTA pLKO.1 644 CDS 100% 4.950 6.930 N ECE2 n/a
2 TRCN0000152984 GCCGGTTTATCTCAATGACTT pLKO.1 544 CDS 100% 4.950 6.930 N ECE2 n/a
3 TRCN0000153549 CCGGTTTATCTCAATGACTTC pLKO.1 545 CDS 100% 4.050 5.670 N ECE2 n/a
4 TRCN0000157367 CCACTTCCATCTCTACCTCAT pLKO.1 650 CDS 100% 4.050 2.835 N ECE2 n/a
5 TRCN0000157815 CCATCTCTACCTCATGCACAA pLKO.1 656 CDS 100% 4.050 2.835 N ECE2 n/a
6 TRCN0000156608 GAGGACTTCCTTAGTGCCATT pLKO.1 777 CDS 100% 4.050 2.835 N ECE2 n/a
7 TRCN0000156442 CTTCCTTAGTGCCATTCAGCT pLKO.1 782 CDS 100% 2.640 1.848 N ECE2 n/a
8 TRCN0000157876 CTTCCCTAATGTGACCAGTGT pLKO.1 278 CDS 100% 2.640 1.320 Y ECE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032331.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07473 pDONR223 100% 99.8% 99.6% None 301C>T n/a
2 ccsbBroad304_07473 pLX_304 0% 99.8% 99.6% V5 301C>T n/a
3 TRCN0000481413 CTAGACGACTTGACTGCAGTCGAC pLX_317 22.8% 99.8% 99.6% V5 301C>T n/a
4 TRCN0000488998 GATTCCACCCGGTGTCTGGGTCAA pLX_317 46.9% 99.8% 99.6% V5 (not translated due to prior stop codon) 301C>T n/a
Download CSV