Transcript: Human NM_032359.4

Homo sapiens cms1 ribosomal small subunit homolog (CMSS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CMSS1 (84319)
Length:
4302
CDS:
119..958

Additional Resources:

NCBI RefSeq record:
NM_032359.4
NBCI Gene record:
CMSS1 (84319)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032359.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072720 CGCTTGGTGATTGAATTAGAA pLKO.1 437 CDS 100% 5.625 7.875 N CMSS1 n/a
2 TRCN0000072722 CGAGATAAGAAAGGAGGTATT pLKO.1 871 CDS 100% 10.800 7.560 N CMSS1 n/a
3 TRCN0000072719 GCAGGTAAAGTTGCTGGAGAA pLKO.1 706 CDS 100% 4.050 2.835 N CMSS1 n/a
4 TRCN0000072721 CCCGAGATAAGAAAGGAGGTA pLKO.1 869 CDS 100% 2.640 1.848 N CMSS1 n/a
5 TRCN0000072718 GCACTCAGTAAATATCAGCAA pLKO.1 1033 3UTR 100% 2.640 1.848 N CMSS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032359.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09181 pDONR223 100% 99.8% 99.6% None 413A>G n/a
2 ccsbBroad304_09181 pLX_304 0% 99.8% 99.6% V5 413A>G n/a
3 TRCN0000470967 AAACATAAGTACGGTTAACTCGCA pLX_317 30.8% 99.8% 99.6% V5 413A>G n/a
Download CSV