Transcript: Human NM_032407.1

Homo sapiens protocadherin gamma subfamily C, 5 (PCDHGC5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PCDHGC5 (56097)
Length:
2637
CDS:
1..2637

Additional Resources:

NCBI RefSeq record:
NM_032407.1
NBCI Gene record:
PCDHGC5 (56097)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056049 GCGTACCTTTGACTATGAATT pLKO.1 1557 CDS 100% 0.000 0.000 N PCDHGC5 n/a
2 TRCN0000056051 CGTGCTGGACATCAATGATAA pLKO.1 693 CDS 100% 13.200 9.240 N PCDHGC5 n/a
3 TRCN0000428685 GACCTGCCATTTCAGATTAAG pLKO_005 1174 CDS 100% 13.200 9.240 N PCDHGC5 n/a
4 TRCN0000415082 ATCCGGATGTGGGCACCAATA pLKO_005 476 CDS 100% 10.800 7.560 N PCDHGC5 n/a
5 TRCN0000056048 GCAGCTTTACACTGCTTACAT pLKO.1 1368 CDS 100% 5.625 3.938 N PCDHGC5 n/a
6 TRCN0000056052 CTTTACCTCATTGTGGCTCTA pLKO.1 2074 CDS 100% 4.050 2.835 N PCDHGC5 n/a
7 TRCN0000056050 GCATCTCAGAATCAGCAGCAT pLKO.1 422 CDS 100% 2.640 1.848 N PCDHGC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08618 pDONR223 100% 99.8% 99.7% None (many diffs) n/a
2 ccsbBroad304_08618 pLX_304 0% 99.8% 99.7% V5 (many diffs) n/a
3 TRCN0000480418 TCGCTGACGTCATCCAGGTAATAT pLX_317 14.6% 99.8% 99.7% V5 (many diffs) n/a
Download CSV