Transcript: Human NM_032476.4

Homo sapiens mitochondrial ribosomal protein S6 (MRPS6), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
MRPS6 (64968)
Length:
931
CDS:
124..501

Additional Resources:

NCBI RefSeq record:
NM_032476.4
NBCI Gene record:
MRPS6 (64968)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032476.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255674 GTGAGAAGATTCGCCAGATTT pLKO_005 498 CDS 100% 13.200 18.480 N MRPS6 n/a
2 TRCN0000255668 ACGTACGATAGAGGCCCTGAT pLKO_005 192 CDS 100% 4.050 5.670 N MRPS6 n/a
3 TRCN0000138844 GCGCTTCCTTATAGGATCTCT pLKO.1 259 CDS 100% 3.000 4.200 N MRPS6 n/a
4 TRCN0000137986 GAATGTGAAGGGATTGTCCCA pLKO.1 433 CDS 100% 0.660 0.528 N MRPS6 n/a
5 TRCN0000255673 ATGTGATTAGAGGGAATATTG pLKO_005 383 CDS 100% 13.200 9.240 N MRPS6 n/a
6 TRCN0000255670 CCCTCTGACCCAGGAACTAAA pLKO_005 411 CDS 100% 13.200 9.240 N MRPS6 n/a
7 TRCN0000255669 GTTGCAGGTGCTGTTTGATTT pLKO_005 602 3UTR 100% 13.200 9.240 N MRPS6 n/a
8 TRCN0000255671 CCAGAGACTGCTGCTACTTTG pLKO_005 169 CDS 100% 10.800 7.560 N MRPS6 n/a
9 TRCN0000136408 CGGGTATTTCTTGGTGGATTT pLKO.1 306 CDS 100% 10.800 7.560 N MRPS6 n/a
10 TRCN0000255667 TCGAGATATAGATGTGATTAG pLKO_005 372 CDS 100% 10.800 7.560 N MRPS6 n/a
11 TRCN0000265702 TGATGGACAGAGGAGCAATAG pLKO_005 209 CDS 100% 10.800 7.560 N MRPS6 n/a
12 TRCN0000265678 GCTACTTTGAAACGTACGATA pLKO_005 181 CDS 100% 4.950 3.465 N MRPS6 n/a
13 TRCN0000137859 GCTTCTCTGTAACCTGCAGTA pLKO.1 687 3UTR 100% 4.050 2.835 N MRPS6 n/a
14 TRCN0000138701 GCAATAGTGAGGGACTTGGAA pLKO.1 223 CDS 100% 3.000 2.100 N MRPS6 n/a
15 TRCN0000255672 TTGCAAGTTTGGCCTTTATAT pLKO_005 573 3UTR 100% 15.000 9.000 N MRPS6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032476.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08883 pDONR223 100% 99.7% 100% None 360A>G n/a
2 ccsbBroad304_08883 pLX_304 0% 99.7% 100% V5 360A>G n/a
3 TRCN0000466813 CATTGACTTTCGGTTTTATATCCT pLX_317 100% 99.7% 100% V5 360A>G n/a
Download CSV