Transcript: Human NM_032592.4

Homo sapiens 1-aminocyclopropane-1-carboxylate synthase homolog (inactive) (ACCS), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ACCS (84680)
Length:
2383
CDS:
433..1938

Additional Resources:

NCBI RefSeq record:
NM_032592.4
NBCI Gene record:
ACCS (84680)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032592.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045572 GTCTACATGCTGTCCGTGTTT pLKO.1 1294 CDS 100% 4.950 6.930 N ACCS n/a
2 TRCN0000045570 CTACAGGAGTACCTGGTATTT pLKO.1 1237 CDS 100% 13.200 9.240 N ACCS n/a
3 TRCN0000421391 AGAATGTGGTTGTCCTGAATG pLKO_005 917 CDS 100% 10.800 7.560 N ACCS n/a
4 TRCN0000417996 AGCAGGTGCTTGCAGGCAAAT pLKO_005 1856 CDS 100% 10.800 7.560 N ACCS n/a
5 TRCN0000434149 CCTACCACATGGATGAGTATG pLKO_005 680 CDS 100% 10.800 7.560 N ACCS n/a
6 TRCN0000433414 GCAAGGCCTTCGAGTGTAAAG pLKO_005 1766 CDS 100% 10.800 7.560 N ACCS n/a
7 TRCN0000045569 CCTGTCCTCTAGAGGAAGAAT pLKO.1 618 CDS 100% 5.625 3.938 N ACCS n/a
8 TRCN0000045571 CTGGGTTGACTTGAGAAAGTA pLKO.1 1668 CDS 100% 5.625 3.938 N ACCS n/a
9 TRCN0000045568 CGTGTGTCTCTATGGCAACAT pLKO.1 1035 CDS 100% 4.950 3.465 N ACCS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032592.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09216 pDONR223 100% 99.8% 99.8% None 871C>T;1262C>T n/a
2 ccsbBroad304_09216 pLX_304 0% 99.8% 99.8% V5 871C>T;1262C>T n/a
3 TRCN0000471768 AAGGAAGATTATGATCTACCGAAT pLX_317 30.7% 99.8% 99.8% V5 871C>T;1262C>T n/a
Download CSV