Transcript: Human NM_032627.5

Homo sapiens single stranded DNA binding protein 4 (SSBP4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SSBP4 (170463)
Length:
1725
CDS:
252..1409

Additional Resources:

NCBI RefSeq record:
NM_032627.5
NBCI Gene record:
SSBP4 (170463)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032627.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016383 GCTGTACGTTTATGAGTACCT pLKO.1 317 CDS 100% 2.640 3.696 N SSBP4 n/a
2 TRCN0000353638 AGTTGGCGCTGTACGTTTATG pLKO_005 310 CDS 100% 13.200 17.160 N SSBP4 n/a
3 TRCN0000016387 GCCCTGGAGATTCCACCAACT pLKO.1 1084 CDS 100% 1.350 1.080 N SSBP4 n/a
4 TRCN0000016386 GCCCTTCATGTCACCGCGCTT pLKO.1 686 CDS 100% 0.000 0.000 N SSBP4 n/a
5 TRCN0000329999 GCCCTTCATGTCACCGCGCTT pLKO_005 686 CDS 100% 0.000 0.000 N SSBP4 n/a
6 TRCN0000330030 CCAAGGCCTTCCAGGACTATA pLKO_005 511 CDS 100% 13.200 9.240 N SSBP4 n/a
7 TRCN0000330000 CACGAAAGACTCTTACCATTT pLKO_005 1544 3UTR 100% 10.800 7.560 N SSBP4 n/a
8 TRCN0000330001 TCCGATGGGAGAAGAACATCA pLKO_005 385 CDS 100% 4.950 3.465 N SSBP4 n/a
9 TRCN0000016385 CCGCGAGAAGTTGGCGCTGTA pLKO.1 302 CDS 100% 0.000 0.000 N SSBP4 n/a
10 TRCN0000016384 CGGGACCTTCCTGCACCCGTT pLKO.1 1346 CDS 100% 0.000 0.000 N SSBP4 n/a
11 TRCN0000348499 ATGACCATGAGCGTGTGATAG pLKO_005 1392 CDS 100% 10.800 6.480 N Ssbp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032627.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05152 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05152 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469420 AAAGTTTCTCCCGTAGGGTCGAAC pLX_317 37.8% 100% 100% V5 n/a
Download CSV