Construct: ORF TRCN0000469420
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015105.1_s317c1
- Derived from:
- ccsbBroadEn_05152
- DNA Barcode:
- AAAGTTTCTCCCGTAGGGTCGAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SSBP4 (170463)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469420
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 170463 | SSBP4 | single stranded DNA binding... | NM_032627.5 | 100% | 100% | |
| 2 | human | 170463 | SSBP4 | single stranded DNA binding... | NM_001009998.4 | 94.2% | 94.2% | 366_367ins66 |
| 3 | human | 170463 | SSBP4 | single stranded DNA binding... | XM_005259790.3 | 92.9% | 88.4% | (many diffs) |
| 4 | human | 170463 | SSBP4 | single stranded DNA binding... | XM_006722666.2 | 88.5% | 86.6% | 1129_1243del;1271_1305del |
| 5 | human | 170463 | SSBP4 | single stranded DNA binding... | XM_017026437.1 | 87.5% | 83.1% | (many diffs) |
| 6 | human | 170463 | SSBP4 | single stranded DNA binding... | XM_006722668.2 | 83.4% | 81.6% | 366_367ins66;1063_1177del;1205_1239del |
| 7 | human | 170463 | SSBP4 | single stranded DNA binding... | XM_006722665.4 | 82.7% | 77.2% | (many diffs) |
| 8 | human | 170463 | SSBP4 | single stranded DNA binding... | XM_017026433.1 | 73.9% | 72.7% | (many diffs) |
| 9 | human | 170463 | SSBP4 | single stranded DNA binding... | XM_017026432.1 | 69.9% | 68.1% | (many diffs) |
| 10 | human | 170463 | SSBP4 | single stranded DNA binding... | XM_017026431.1 | 69.7% | 65.5% | (many diffs) |
| 11 | human | 170463 | SSBP4 | single stranded DNA binding... | XM_017026436.1 | 69.6% | 68.5% | (many diffs) |
| 12 | human | 170463 | SSBP4 | single stranded DNA binding... | XM_017026435.1 | 65.8% | 63.9% | (many diffs) |
| 13 | human | 170463 | SSBP4 | single stranded DNA binding... | XM_017026434.2 | 65.6% | 61.4% | (many diffs) |
| 14 | human | 170463 | SSBP4 | single stranded DNA binding... | XR_936163.3 | 61.5% | (many diffs) | |
| 15 | human | 170463 | SSBP4 | single stranded DNA binding... | XR_936164.3 | 57.9% | (many diffs) | |
| 16 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NM_001372473.1 | 81.6% | 81% | (many diffs) |
| 17 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NM_133772.3 | 80.5% | 83.6% | (many diffs) |
| 18 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NM_001372475.1 | 76.4% | 79.2% | (many diffs) |
| 19 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | XM_006509790.4 | 76.3% | 74.5% | (many diffs) |
| 20 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | XM_011242337.3 | 76.1% | 75.7% | (many diffs) |
| 21 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NM_001372471.1 | 75.2% | 76.8% | (many diffs) |
| 22 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NM_001372472.1 | 75.2% | 76.8% | (many diffs) |
| 23 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NM_001372470.1 | 75.1% | 78% | (many diffs) |
| 24 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | XM_030243848.1 | 71.3% | 72.6% | (many diffs) |
| 25 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | XM_011242338.3 | 71.2% | 73.9% | (many diffs) |
| 26 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NM_001372468.1 | 70.4% | 71.9% | (many diffs) |
| 27 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | XM_011242336.3 | 69.2% | 66.3% | (many diffs) |
| 28 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NM_001372469.1 | 66.8% | 68% | (many diffs) |
| 29 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NM_001372477.1 | 58.6% | 59.5% | (many diffs) |
| 30 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NM_001372478.1 | 58.6% | 59.5% | (many diffs) |
| 31 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NM_001372479.1 | 58.6% | 59.5% | (many diffs) |
| 32 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NR_164176.1 | 57.1% | (many diffs) | |
| 33 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NM_001372476.1 | 54.6% | 54.1% | (many diffs) |
| 34 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NR_164178.1 | 53.4% | (many diffs) | |
| 35 | mouse | 76900 | Ssbp4 | single stranded DNA binding... | NR_164177.1 | 53.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1221
- ORF length:
- 1155
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgta cgccaagggg ggcaagggtt cggccgtgcc ctccgacagc caggcccgcg 121 agaagttggc gctgtacgtt tatgagtacc tgctgcacat cggtgcccag aagtcagccc 181 agaccttcct gtctgagatc cgatgggaga agaacatcac gctgggggag ccccctgggt 241 tcctgcactc ctggtggtgc gtcttctggg acctgtactg cgcggcgcct gacagaagag 301 aggcctgcga gcactccggc gaggccaagg ccttccagga ctatagtgct gcagccgccc 361 ccagccccgt tatggggagt atggccccag gtgacacaat ggccgcaggc tccatggcgg 421 ctggcttctt ccagggcccc cccggctccc agccgtcccc ccacaacccc aacgccccca 481 tgatggggcc tcacggtcag cccttcatgt caccgcgctt cccagggggc ccccggccca 541 ccctgcggat gccgagtcag cctcccgcag gcctccctgg ctcccagccc ctcctccctg 601 gcgccatgga gccctcccca cgagcccagg ggcatccgag catgggcggc ccaatgcaga 661 gggtgacgcc tcctcgtggc atggccagcg tggggcccca gagctatgga ggtggcatgc 721 gacccccacc caactccctc gccggcccag gcctgcctgc catgaacatg ggcccaggag 781 ttcgtgGCCC GTGGGCCAGC CCCAGTGGAA ACTCGATCCC CTACTCCTCC TCATCCCCCG 841 GCAGCTACAC CGGACCCCCA GGAGGAGGTG GGCCCCCTGG AACACCCATC ATGCCTAGCC 901 CTGGAGATTC CACCAACTCC AGCGAAAACA TGTACACTAT CATGAACCCC ATCGGGCAGG 961 GCGCCGGCAG GGCTAATTTC CCGCTCGGCC CTGGCCCGGA GGGCCCCATG GCCGCCATGA 1021 GCGCGATGGA GCCTCACCAC GTGAACGGAT CCCTGGGCTC GGGCGACATG GACGGGTTGC 1081 CGAAGAGTTC CCCCGGCGCC GTGGCCGGCC TGAGCAACGC CCCGGGCACC CCGCGGGACG 1141 ACGGCGAGAT GGCGGCCGCC GGGACCTTCC TGCACCCGTT CCCGAGCGAA AGCTACTCGC 1201 CAGGGATGAC CATGAGCGTG TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1261 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1321 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAAAG TTTCTCCCGT 1381 AGGGTCGAAC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt