Transcript: Human NM_032718.5

Homo sapiens major facilitator superfamily domain containing 9 (MFSD9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MFSD9 (84804)
Length:
5293
CDS:
79..1503

Additional Resources:

NCBI RefSeq record:
NM_032718.5
NBCI Gene record:
MFSD9 (84804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032718.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005747 GCCGCTTGTAATCGGACACTT pLKO.1 573 CDS 100% 4.950 6.930 N MFSD9 n/a
2 TRCN0000434739 GTCATGCTGTACTACAGTAAC pLKO_005 973 CDS 100% 10.800 8.640 N MFSD9 n/a
3 TRCN0000005745 GCTGGTCTCGTTTGGTTCTTT pLKO.1 712 CDS 100% 5.625 4.500 N MFSD9 n/a
4 TRCN0000010963 GCCACCAATGTGTTTCTGTTT pLKO.1 463 CDS 100% 4.950 3.960 N MFSD9 n/a
5 TRCN0000005746 CTAGTGGTGATGGGAATAGTA pLKO.1 1466 CDS 100% 0.000 0.000 N MFSD9 n/a
6 TRCN0000433033 ACTTGAGTTTCCAGTTAAATT pLKO_005 1943 3UTR 100% 15.000 10.500 N MFSD9 n/a
7 TRCN0000417729 TCCGAAATGTGGGACATATTT pLKO_005 925 CDS 100% 15.000 10.500 N MFSD9 n/a
8 TRCN0000425727 GATGGATTTGGACAACATAAA pLKO_005 1503 CDS 100% 13.200 9.240 N MFSD9 n/a
9 TRCN0000424942 GTGGCTATCTCACTGAATTAG pLKO_005 638 CDS 100% 13.200 9.240 N MFSD9 n/a
10 TRCN0000418315 CATCTCAAGGGCTCTACTTTC pLKO_005 528 CDS 100% 10.800 7.560 N MFSD9 n/a
11 TRCN0000413989 GTGAGCATATTCAGCGTTTAC pLKO_005 1734 3UTR 100% 10.800 7.560 N MFSD9 n/a
12 TRCN0000420031 TGTTAGCCTTAGTGGCCATTT pLKO_005 1418 CDS 100% 10.800 7.560 N MFSD9 n/a
13 TRCN0000101988 CATGCTGTACTACAGTAACTT pLKO.1 975 CDS 100% 5.625 3.938 N Mfsd9 n/a
14 TRCN0000005744 GCCAAGAAATCCGTGGTGTTT pLKO.1 2107 3UTR 100% 4.950 3.465 N MFSD9 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2611 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032718.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09224 pDONR223 98.8% 99.9% 100% None 1335C>T n/a
2 ccsbBroad304_09224 pLX_304 0% 99.9% 100% V5 1335C>T n/a
Download CSV