Transcript: Human NM_032772.6

Homo sapiens zinc finger protein 503 (ZNF503), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
ZNF503 (84858)
Length:
3205
CDS:
346..2286

Additional Resources:

NCBI RefSeq record:
NM_032772.6
NBCI Gene record:
ZNF503 (84858)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032772.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431946 TTGCGGACCCATACGGCATTT pLKO_005 1960 CDS 100% 10.800 15.120 N ZNF503 n/a
2 TRCN0000143142 CGGGATTAATGTGGATGTGAA pLKO.1 1209 CDS 100% 4.950 6.930 N ZNF503 n/a
3 TRCN0000141104 CTACGGCTTTATGCTCCCTAA pLKO.1 1851 CDS 100% 4.050 5.670 N ZNF503 n/a
4 TRCN0000415263 GGCGCAAACATGTTCGCAGAT pLKO_005 693 CDS 100% 4.050 5.670 N ZNF503 n/a
5 TRCN0000142315 GAGTTTCAAGCCGTACTCCAA pLKO.1 864 CDS 100% 2.640 3.696 N ZNF503 n/a
6 TRCN0000141700 CAAGTCGAGTTTCAAGCCGTA pLKO.1 858 CDS 100% 2.160 3.024 N ZNF503 n/a
7 TRCN0000415430 AGTTTGAGCTCTGTAGGTAAA pLKO_005 2657 3UTR 100% 10.800 7.560 N ZNF503 n/a
8 TRCN0000144218 CCACGAAAGGAAAGAAATGTA pLKO.1 2400 3UTR 100% 5.625 3.938 N ZNF503 n/a
9 TRCN0000143385 GCCACGAAAGGAAAGAAATGT pLKO.1 2399 3UTR 100% 5.625 3.938 N ZNF503 n/a
10 TRCN0000142037 GCCAATCAAGGTGCTGAAGAT pLKO.1 561 CDS 100% 4.950 3.465 N ZNF503 n/a
11 TRCN0000141354 CCTAAGAAGCAGTAAGCACAG pLKO.1 372 CDS 100% 2.250 1.575 N ZNF503 n/a
12 TRCN0000122399 GCTGGGACTCAGCAGCCGCTA pLKO.1 2130 CDS 100% 0.000 0.000 N ZNF503 n/a
13 TRCN0000142268 GTGTTCATCTGAGGACTGCAT pLKO.1 2571 3UTR 100% 2.640 1.584 N ZNF503 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032772.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09227 pDONR223 100% 99.9% 99.8% None 66A>N n/a
2 ccsbBroad304_09227 pLX_304 0% 99.9% 99.8% V5 66A>N n/a
3 ccsbBroadEn_16045 pDONR223 0% 94.2% 94.2% None 66A>C;695_805del n/a
4 ccsbBroad304_16045 pLX_304 0% 94.2% 94.2% V5 66A>C;695_805del n/a
5 TRCN0000471349 CTGCCCAGGTGGACGCTTCCCGTC pLX_317 20.9% 94.1% 94.1% V5 66A>C;695_805del;1937A>C n/a
Download CSV