Transcript: Human NM_032839.3

Homo sapiens solute carrier family 49 member 4 (SLC49A4), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SLC49A4 (84925)
Length:
3322
CDS:
125..1561

Additional Resources:

NCBI RefSeq record:
NM_032839.3
NBCI Gene record:
SLC49A4 (84925)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032839.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428423 GAATAGCAGCGTGCCTATATT pLKO_005 1303 CDS 100% 15.000 21.000 N SLC49A4 n/a
2 TRCN0000413032 TGTGGTTGTCTCCGTTTAATA pLKO_005 1543 CDS 100% 15.000 21.000 N SLC49A4 n/a
3 TRCN0000083155 GCATACCTATATCAGACTTAA pLKO.1 528 CDS 100% 13.200 18.480 N SLC49A4 n/a
4 TRCN0000083154 GCGCATATTAAAGATCGCATA pLKO.1 788 CDS 100% 4.050 5.670 N SLC49A4 n/a
5 TRCN0000083157 CGGAGAAGCGTTTGTAGATTA pLKO.1 932 CDS 100% 13.200 10.560 N SLC49A4 n/a
6 TRCN0000432023 TTGGAGTTGTCTGCTTAATAT pLKO_005 831 CDS 100% 15.000 10.500 N SLC49A4 n/a
7 TRCN0000416319 ATAAAGCACTACCTAAGTAAT pLKO_005 1826 3UTR 100% 13.200 9.240 N SLC49A4 n/a
8 TRCN0000083153 CCAGTGCTAAACTACTGATTA pLKO.1 1864 3UTR 100% 13.200 9.240 N SLC49A4 n/a
9 TRCN0000083156 GCCATACCACTTGGTGTATTT pLKO.1 992 CDS 100% 13.200 9.240 N SLC49A4 n/a
10 TRCN0000431750 TTCAAACCCTGTATCCAATTT pLKO_005 1989 3UTR 100% 13.200 9.240 N SLC49A4 n/a
11 TRCN0000425411 GTGCTTCAGGGAATCCTATGA pLKO_005 1507 CDS 100% 4.950 3.465 N SLC49A4 n/a
12 TRCN0000423465 GATATGCCACTAACTTCTAAA pLKO_005 1964 3UTR 100% 13.200 7.920 N SLC49A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032839.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14321 pDONR223 100% 99.9% 99.1% None 1422delG n/a
2 ccsbBroad304_14321 pLX_304 0% 99.9% 99.1% V5 (not translated due to frame shift) 1422delG n/a
3 TRCN0000477346 CTCAAGGAAGTCTACGTTTCCCAG pLX_317 31% 99.9% 99.1% V5 (not translated due to frame shift) 1422delG n/a
Download CSV