Transcript: Human NM_032847.3

Homo sapiens chromosome 8 open reading frame 76 (C8orf76), mRNA.

Source:
NCBI, updated 2019-07-15
Taxon:
Homo sapiens (human)
Gene:
C8orf76 (84933)
Length:
1310
CDS:
32..1174

Additional Resources:

NCBI RefSeq record:
NM_032847.3
NBCI Gene record:
C8orf76 (84933)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032847.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197486 CAGAAAGATCAAAGACCATTT pLKO.1 1105 CDS 100% 10.800 7.560 N 9130401M01Rik n/a
2 TRCN0000147044 CAAGTGGTTCAGAAAGATCAA pLKO.1 1096 CDS 100% 4.950 3.465 N C8orf76 n/a
3 TRCN0000281593 CAACCAACACAGACCATTTAA pLKO_005 399 CDS 100% 15.000 7.500 Y C8orf76 n/a
4 TRCN0000263713 ACCTTGCCTGAGAGCTCTTTA pLKO_005 686 CDS 100% 13.200 6.600 Y C8orf76 n/a
5 TRCN0000263714 ATGAGAAAGCTCTGACAAATA pLKO_005 744 CDS 100% 13.200 6.600 Y C8orf76 n/a
6 TRCN0000263716 CTACCTCCAGCTTGCTATTTG pLKO_005 430 CDS 100% 13.200 6.600 Y C8orf76 n/a
7 TRCN0000263715 GTGGAAGCGAATAGCAGTAAT pLKO_005 713 CDS 100% 13.200 6.600 Y C8orf76 n/a
8 TRCN0000147765 GAAGACACTTTGCTGTTGATA pLKO.1 953 CDS 100% 5.625 2.813 Y C8orf76 n/a
9 TRCN0000146794 CCTGCAGAAACTGATTTCTTT pLKO.1 487 CDS 100% 0.563 0.281 Y C8orf76 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032847.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12884 pDONR223 100% 75.7% 73% None (many diffs) n/a
2 ccsbBroad304_12884 pLX_304 0% 75.7% 73% V5 (many diffs) n/a
3 TRCN0000479658 ACTTGTCGGCCGCATCTTTATAGT pLX_317 46.8% 75.7% 73% V5 (many diffs) n/a
Download CSV