Transcript: Human NM_032898.5

Homo sapiens centrosomal protein 19 (CEP19), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
CEP19 (84984)
Length:
2158
CDS:
393..884

Additional Resources:

NCBI RefSeq record:
NM_032898.5
NBCI Gene record:
CEP19 (84984)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032898.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172663 GCGCATTATGCCAGTTCGAAA pLKO.1 485 CDS 100% 4.950 6.930 N CEP19 n/a
2 TRCN0000282778 CCAGAGCTGCTGAACAATTAA pLKO_005 529 CDS 100% 15.000 10.500 N CEP19 n/a
3 TRCN0000263711 GTTTCAGCCTCCAGCTATTAT pLKO_005 425 CDS 100% 15.000 10.500 N CEP19 n/a
4 TRCN0000263712 TGGGAAATCCACCCATAATAA pLKO_005 1955 3UTR 100% 15.000 10.500 N CEP19 n/a
5 TRCN0000282780 GGCAGAAACAATGGAACAAAT pLKO_005 650 CDS 100% 13.200 9.240 N CEP19 n/a
6 TRCN0000282782 TATGACATTGAGGTTGAATTT pLKO_005 804 CDS 100% 13.200 9.240 N CEP19 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1124 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1125 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 1197 3UTR 100% 4.050 2.025 Y TLCD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032898.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12898 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12898 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466177 ATCTAAACCGTCTGAATTAATACA pLX_317 59.7% 100% 100% V5 n/a
Download CSV