Transcript: Human NM_032962.4

Homo sapiens C-C motif chemokine ligand 14 (CCL14), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CCL14 (6358)
Length:
579
CDS:
80..409

Additional Resources:

NCBI RefSeq record:
NM_032962.4
NBCI Gene record:
CCL14 (6358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032962.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371655 CCTAGGGACCAAGACTGAATC pLKO_005 130 CDS 100% 10.800 5.400 Y CCL14 n/a
2 TRCN0000057849 CAGCGGATTATGGATTACTAT pLKO.1 266 CDS 100% 5.625 2.813 Y CCL14 n/a
3 TRCN0000057852 CAAGCCCGGAATTGTCTTCAT pLKO.1 307 CDS 100% 4.950 2.475 Y CCL14 n/a
4 TRCN0000057851 CACCTACACTACCTACAAGAT pLKO.1 238 CDS 100% 4.950 2.475 Y CCL14 n/a
5 TRCN0000377682 AGAGTGCTGCTTCACCTACAC pLKO_005 226 CDS 100% 4.050 2.025 Y CCL14 n/a
6 TRCN0000057848 CCAGGACTATATCAAGGACAT pLKO.1 376 CDS 100% 4.050 2.025 Y CCL14 n/a
7 TRCN0000377739 AGATCCCGCGTCAGCGGATTA pLKO_005 255 CDS 100% 3.600 1.800 Y CCL14 n/a
8 TRCN0000057850 CGGAATTGTCTTCATCACCAA pLKO.1 313 CDS 100% 2.640 1.320 Y CCL14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032962.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01501 pDONR223 100% 85.3% 84.4% None 80_127del n/a
2 ccsbBroad304_01501 pLX_304 0% 85.3% 84.4% V5 80_127del n/a
3 TRCN0000479461 AAGCTGACAGAAATTTGGCCGTTG pLX_317 100% 85.3% 84.4% V5 80_127del n/a
Download CSV