Transcript: Human NM_032963.4

Homo sapiens C-C motif chemokine ligand 14 (CCL14), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CCL14 (6358)
Length:
875
CDS:
81..362

Additional Resources:

NCBI RefSeq record:
NM_032963.4
NBCI Gene record:
CCL14 (6358)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032963.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371655 CCTAGGGACCAAGACTGAATC pLKO_005 131 CDS 100% 10.800 5.400 Y CCL14 n/a
2 TRCN0000057849 CAGCGGATTATGGATTACTAT pLKO.1 219 CDS 100% 5.625 2.813 Y CCL14 n/a
3 TRCN0000057852 CAAGCCCGGAATTGTCTTCAT pLKO.1 260 CDS 100% 4.950 2.475 Y CCL14 n/a
4 TRCN0000057851 CACCTACACTACCTACAAGAT pLKO.1 191 CDS 100% 4.950 2.475 Y CCL14 n/a
5 TRCN0000377682 AGAGTGCTGCTTCACCTACAC pLKO_005 179 CDS 100% 4.050 2.025 Y CCL14 n/a
6 TRCN0000057848 CCAGGACTATATCAAGGACAT pLKO.1 329 CDS 100% 4.050 2.025 Y CCL14 n/a
7 TRCN0000377739 AGATCCCGCGTCAGCGGATTA pLKO_005 208 CDS 100% 3.600 1.800 Y CCL14 n/a
8 TRCN0000057850 CGGAATTGTCTTCATCACCAA pLKO.1 266 CDS 100% 2.640 1.320 Y CCL14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032963.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01501 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01501 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479461 AAGCTGACAGAAATTTGGCCGTTG pLX_317 100% 100% 100% V5 n/a
Download CSV