Transcript: Human NM_032965.6

Homo sapiens C-C motif chemokine ligand 15 (CCL15), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CCL15 (6359)
Length:
588
CDS:
62..403

Additional Resources:

NCBI RefSeq record:
NM_032965.6
NBCI Gene record:
CCL15 (6359)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032965.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057886 GCTGAAGCCCTACTCAATATA pLKO.1 382 CDS 100% 15.000 7.500 Y CCL15 n/a
2 TRCN0000371599 ACAGAGTTAATGATGTCAAAG pLKO_005 146 CDS 100% 10.800 5.400 Y CCL15 n/a
3 TRCN0000377734 ATCCCGTGTTCACTCATGAAA pLKO_005 245 CDS 100% 5.625 2.813 Y CCL15 n/a
4 TRCN0000377741 CCAAGCCAGGTGTCATATTCC pLKO_005 294 CDS 100% 4.950 2.475 Y CCL15 n/a
5 TRCN0000057883 CCAGTAGTTCTGAACAGCTTT pLKO.1 182 CDS 100% 4.950 2.475 Y CCL15 n/a
6 TRCN0000057884 GCACCTCCTACATCTCACAAA pLKO.1 222 CDS 100% 4.950 2.475 Y CCL15 n/a
7 TRCN0000057887 CGGGAGTTCAGGATTGCATGA pLKO.1 357 CDS 100% 4.050 2.025 Y CCL15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032965.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06919 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_06919 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475632 GAGATCTTCCTTTCGAATGGCGTT pLX_317 81.7% 100% 100% V5 n/a
4 ccsbBroadEn_06921 pDONR223 100% 81.8% 68.3% None (many diffs) n/a
5 ccsbBroad304_06921 pLX_304 0% 81.8% 68.3% V5 (many diffs) n/a
6 TRCN0000480812 GCTTCGGCTGTTAAGTCCGCCTTC pLX_317 100% 81.8% 68.3% V5 (many diffs) n/a
Download CSV