Transcript: Human NM_033025.6

Homo sapiens synapse defective Rho GTPase homolog 1 (SYDE1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SYDE1 (85360)
Length:
3252
CDS:
34..2241

Additional Resources:

NCBI RefSeq record:
NM_033025.6
NBCI Gene record:
SYDE1 (85360)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033025.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179631 GCTGCCAACCAAATCAGTATT pLKO.1 2640 3UTR 100% 13.200 18.480 N SYDE1 n/a
2 TRCN0000179630 GCACCTGAATCTCAAAGACTT pLKO.1 2160 CDS 100% 4.950 3.960 N SYDE1 n/a
3 TRCN0000146850 CAAGGATTATCTTCGAGAGTT pLKO.1 1458 CDS 100% 4.950 3.465 N SYDE1 n/a
4 TRCN0000180600 GCTGAGACTCATTCCCAGTTT pLKO.1 2389 3UTR 100% 4.950 3.465 N SYDE1 n/a
5 TRCN0000148300 CTCCATAAAGATGAAGAAGCT pLKO.1 531 CDS 100% 2.640 1.584 N SYDE1 n/a
6 TRCN0000105681 CACCTGAATCTCAAAGACTTT pLKO.1 2161 CDS 100% 4.950 3.465 N Syde1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033025.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12910 pDONR223 100% 90.8% 90.8% None 88_288del n/a
2 ccsbBroad304_12910 pLX_304 0% 90.8% 90.8% V5 88_288del n/a
3 TRCN0000475649 TAACTCCCCCACTGTCACAGCAAG pLX_317 10.8% 90.8% 90.8% V5 88_288del n/a
Download CSV