Transcript: Mouse NM_033037.3

Mus musculus cysteine dioxygenase 1, cytosolic (Cdo1), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Cdo1 (12583)
Length:
1530
CDS:
201..803

Additional Resources:

NCBI RefSeq record:
NM_033037.3
NBCI Gene record:
Cdo1 (12583)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033037.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076427 GTATGCCAAATTCGATCAATA pLKO.1 347 CDS 100% 13.200 18.480 N Cdo1 n/a
2 TRCN0000338045 ATTCGATCAATACAGGTATAC pLKO_005 356 CDS 100% 10.800 15.120 N Cdo1 n/a
3 TRCN0000338153 TCGATACATGCCACGCCTTTG pLKO_005 682 CDS 100% 6.000 8.400 N Cdo1 n/a
4 TRCN0000076426 TGTATGCCAAATTCGATCAAT pLKO.1 346 CDS 100% 5.625 7.875 N Cdo1 n/a
5 TRCN0000076424 GCCTACATTAATGATTCCATT pLKO.1 591 CDS 100% 4.950 6.930 N Cdo1 n/a
6 TRCN0000338039 CTGGTCTCTGAACTCTAATAA pLKO_005 1180 3UTR 100% 15.000 10.500 N Cdo1 n/a
7 TRCN0000076423 GCTGTCCAGTTACACAGTTAA pLKO.1 882 3UTR 100% 13.200 9.240 N Cdo1 n/a
8 TRCN0000338107 TTGGAATCAGGACTCCATTTA pLKO_005 754 CDS 100% 13.200 9.240 N Cdo1 n/a
9 TRCN0000338038 GATGATCAAGAAGTCTGAAAG pLKO_005 548 CDS 100% 10.800 7.560 N Cdo1 n/a
10 TRCN0000076425 GTTTGGAATCAGGACTCCATT pLKO.1 752 CDS 100% 4.950 3.465 N Cdo1 n/a
11 TRCN0000056589 GCAGCAGTATTCATGATCATA pLKO.1 445 CDS 100% 5.625 3.938 N CDO1 n/a
12 TRCN0000306765 GCAGCAGTATTCATGATCATA pLKO_005 445 CDS 100% 5.625 3.938 N CDO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033037.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05981 pDONR223 100% 87.1% 91.5% None (many diffs) n/a
2 ccsbBroad304_05981 pLX_304 0% 87.1% 91.5% V5 (many diffs) n/a
3 TRCN0000466964 TACCGGGCAGGACGAATCGCAGGC pLX_317 79.6% 87.1% 91.5% V5 (many diffs) n/a
Download CSV