Transcript: Human NM_033199.4

Homo sapiens urocortin 2 (UCN2), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
UCN2 (90226)
Length:
1498
CDS:
92..430

Additional Resources:

NCBI RefSeq record:
NM_033199.4
NBCI Gene record:
UCN2 (90226)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033199.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373919 GCATTGTCCTATCGCTGGATG pLKO_005 303 CDS 100% 4.050 5.670 N UCN2 n/a
2 TRCN0000157999 CCACTGTCATGCAGGTCATAT pLKO.1 584 3UTR 100% 13.200 9.240 N UCN2 n/a
3 TRCN0000151416 GCAGTCATCATCATGTTACTT pLKO.1 827 3UTR 100% 5.625 3.938 N UCN2 n/a
4 TRCN0000157895 CCTGGACATTGGACATTGCTA pLKO.1 646 3UTR 100% 3.000 2.100 N UCN2 n/a
5 TRCN0000158035 CCTCTTGCAGATCTTACTGGA pLKO.1 334 CDS 100% 2.640 1.848 N UCN2 n/a
6 TRCN0000158261 CTTGCAGATCTTACTGGAGCA pLKO.1 337 CDS 100% 2.160 1.512 N UCN2 n/a
7 TRCN0000373836 CACAGGTCTGTCATCCCATAG pLKO_005 903 3UTR 100% 6.000 3.000 Y UCN2 n/a
8 TRCN0000153965 CCTCGGTTTCCTTATCTGTAA pLKO.1 1368 3UTR 100% 4.950 2.475 Y UCN2 n/a
9 TRCN0000373920 CAACACGAGAGCTCAACACTG pLKO_005 858 3UTR 100% 4.050 2.025 Y UCN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033199.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04508 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04508 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478784 CAAAATCATATTTAGTCCCTGAAG pLX_317 100% 100% 100% V5 n/a
Download CSV