Transcript: Human NM_033240.3

Homo sapiens promyelocytic leukemia (PML), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
PML (5371)
Length:
3671
CDS:
98..1933

Additional Resources:

NCBI RefSeq record:
NM_033240.3
NBCI Gene record:
PML (5371)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033240.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355998 AGGGACCCTATTGACGTTGAC pLKO_005 1328 CDS 100% 4.050 5.670 N PML n/a
2 TRCN0000003867 GCCAGTGTACGCCTTCTCCAT pLKO.1 1453 CDS 100% 0.880 1.232 N PML n/a
3 TRCN0000003869 GTGTACGCCTTCTCCATCAAA pLKO.1 1457 CDS 100% 5.625 3.938 N PML n/a
4 TRCN0000314547 GTGTACGCCTTCTCCATCAAA pLKO_005 1457 CDS 100% 5.625 3.938 N PML n/a
5 TRCN0000355997 AGATGCAGCTGTATCCAAGAA pLKO_005 1279 CDS 100% 4.950 3.465 N PML n/a
6 TRCN0000003866 CACCCGCAAGACCAACAACAT pLKO.1 637 CDS 100% 4.950 3.465 N PML n/a
7 TRCN0000314603 CACCCGCAAGACCAACAACAT pLKO_005 637 CDS 100% 4.950 3.465 N PML n/a
8 TRCN0000355996 TCGGAGGAGGAGTTCCAGTTT pLKO_005 239 CDS 100% 4.950 3.465 N PML n/a
9 TRCN0000003865 CAATACAACGACAGCCCAGAA pLKO.1 1504 CDS 100% 4.050 2.835 N PML n/a
10 TRCN0000003868 GTGTACCGGCAGATTGTGGAT pLKO.1 449 CDS 100% 2.640 1.848 N PML n/a
11 TRCN0000314546 GTGTACCGGCAGATTGTGGAT pLKO_005 449 CDS 100% 2.640 1.848 N PML n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033240.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06742 pDONR223 100% 66.5% 63.8% None (many diffs) n/a
2 ccsbBroad304_06742 pLX_304 0% 66.5% 63.8% V5 (many diffs) n/a
3 TRCN0000467855 GAGCAATGACACAATTTGACCTCG pLX_317 16.5% 66.5% 63.8% V5 (many diffs) n/a
Download CSV