Transcript: Human NM_033281.6

Homo sapiens mitochondrial ribosomal protein S36 (MRPS36), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
MRPS36 (92259)
Length:
1315
CDS:
71..382

Additional Resources:

NCBI RefSeq record:
NM_033281.6
NBCI Gene record:
MRPS36 (92259)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033281.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423335 CCAGACACTGCAGAAATAATA pLKO_005 281 CDS 100% 15.000 10.500 N MRPS36 n/a
2 TRCN0000430911 GACACTTGTATTTCCTAATTT pLKO_005 521 3UTR 100% 15.000 10.500 N MRPS36 n/a
3 TRCN0000428205 CAATCCTAAACCCAATGTATC pLKO_005 160 CDS 100% 10.800 7.560 N MRPS36 n/a
4 TRCN0000153003 GTCAAACCACACACTCCATTA pLKO.1 116 CDS 100% 10.800 7.560 N MRPS36 n/a
5 TRCN0000428236 ACAACATTCTAAAGGAAGTAA pLKO_005 229 CDS 100% 5.625 3.938 N MRPS36 n/a
6 TRCN0000182936 CCATTAACCTTCTCAAACTTA pLKO.1 1153 3UTR 100% 5.625 3.938 N MRPS36 n/a
7 TRCN0000154185 CTACCATCTCACTCTTCTGTA pLKO.1 203 CDS 100% 4.950 3.465 N MRPS36 n/a
8 TRCN0000427666 GGAAACTTGTGTCTCAAGAAG pLKO_005 327 CDS 100% 4.950 3.465 N MRPS36 n/a
9 TRCN0000417518 TAAGGTTTCCTGACAGAAGAG pLKO_005 138 CDS 100% 4.050 2.835 N MRPS36 n/a
10 TRCN0000153325 GATTTGCTGATGTATCAGGGT pLKO.1 257 CDS 100% 0.660 0.462 N MRPS36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033281.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04573 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04573 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465904 AGTACCGCGTCTGTCCTGGATTCA pLX_317 100% 100% 100% V5 n/a
Download CSV