Transcript: Mouse NM_033314.3

Mus musculus solute carrier organic anion transporter family, member 2a1 (Slco2a1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Slco2a1 (24059)
Length:
4033
CDS:
132..2063

Additional Resources:

NCBI RefSeq record:
NM_033314.3
NBCI Gene record:
Slco2a1 (24059)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033314.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079872 ACAGGTAATCTACAAGGTCTT pLKO.1 1955 CDS 100% 4.050 5.670 N Slco2a1 n/a
2 TRCN0000332081 ACAGGTAATCTACAAGGTCTT pLKO_005 1955 CDS 100% 4.050 5.670 N Slco2a1 n/a
3 TRCN0000079869 GCCTATGCCAACTTACTCATT pLKO.1 1212 CDS 100% 4.950 3.960 N Slco2a1 n/a
4 TRCN0000332020 GCCTATGCCAACTTACTCATT pLKO_005 1212 CDS 100% 4.950 3.960 N Slco2a1 n/a
5 TRCN0000079868 CCACCACTTTGGGAAGTATAA pLKO.1 2710 3UTR 100% 13.200 9.240 N Slco2a1 n/a
6 TRCN0000332019 CCACCACTTTGGGAAGTATAA pLKO_005 2710 3UTR 100% 13.200 9.240 N Slco2a1 n/a
7 TRCN0000079871 GCTCGGTCTTCAACAACATTA pLKO.1 205 CDS 100% 13.200 9.240 N Slco2a1 n/a
8 TRCN0000079870 CGCTCGGTCTTCAACAACATT pLKO.1 204 CDS 100% 5.625 3.938 N Slco2a1 n/a
9 TRCN0000332083 CGCTCGGTCTTCAACAACATT pLKO_005 204 CDS 100% 5.625 3.938 N Slco2a1 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2187 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033314.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01552 pDONR223 100% 84.6% 83% None (many diffs) n/a
2 ccsbBroad304_01552 pLX_304 0% 84.6% 83% V5 (many diffs) n/a
3 TRCN0000479346 GCACATAGCTTGCCCCGAACTAGC pLX_317 22.6% 84.6% 83% V5 (many diffs) n/a
Download CSV