Transcript: Mouse NM_033526.2

Mus musculus ubiquilin 4 (Ubqln4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ubqln4 (94232)
Length:
3372
CDS:
90..1880

Additional Resources:

NCBI RefSeq record:
NM_033526.2
NBCI Gene record:
Ubqln4 (94232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033526.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000331445 AGTGTCCCGGGAGGGTATAAT pLKO_005 894 CDS 100% 15.000 21.000 N Ubqln4 n/a
2 TRCN0000092674 CCGATGCCAGAAGTGAGATTT pLKO.1 1731 CDS 100% 13.200 18.480 N Ubqln4 n/a
3 TRCN0000326132 CCGATGCCAGAAGTGAGATTT pLKO_005 1731 CDS 100% 13.200 18.480 N Ubqln4 n/a
4 TRCN0000311479 GGGACATCAATGCCGCTATTG pLKO_005 1831 CDS 100% 10.800 15.120 N Ubqln4 n/a
5 TRCN0000092676 GAGATCGTGATCTGCGATCAA pLKO.1 162 CDS 100% 0.495 0.693 N Ubqln4 n/a
6 TRCN0000092677 CGCACCATGATGCAGACGCTT pLKO.1 1293 CDS 100% 0.880 0.704 N Ubqln4 n/a
7 TRCN0000011104 CGGGAACAGTTTGGCAACAAT pLKO.1 966 CDS 100% 5.625 3.938 N UBQLN4 n/a
8 TRCN0000092673 CCAGTTTGAATCTCACTCTTT pLKO.1 2300 3UTR 100% 4.950 3.465 N Ubqln4 n/a
9 TRCN0000326133 CCAGTTTGAATCTCACTCTTT pLKO_005 2300 3UTR 100% 4.950 3.465 N Ubqln4 n/a
10 TRCN0000007741 GCTGCTCAGATGATGGTGAAT pLKO.1 1332 CDS 100% 4.950 3.465 N UBQLN4 n/a
11 TRCN0000092675 CCCAGCCATGATGCAAGAAAT pLKO.1 836 CDS 100% 13.200 7.920 N Ubqln4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033526.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12308 pDONR223 100% 9.3% 9.8% None (many diffs) n/a
2 ccsbBroad304_12308 pLX_304 0% 9.3% 9.8% V5 (many diffs) n/a
3 TRCN0000475191 CTTGTTGACGTACAAACAAGAGTA pLX_317 100% 9.3% 9.8% V5 (many diffs) n/a
Download CSV