Transcript: Human NM_033540.3

Homo sapiens mitofusin 1 (MFN1), mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MFN1 (55669)
Length:
5212
CDS:
110..2335

Additional Resources:

NCBI RefSeq record:
NM_033540.3
NBCI Gene record:
MFN1 (55669)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033540.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051835 GCGGCTTTCCAAGCCTAATAT pLKO.1 784 CDS 100% 15.000 21.000 N MFN1 n/a
2 TRCN0000300842 GCGGCTTTCCAAGCCTAATAT pLKO_005 784 CDS 100% 15.000 21.000 N MFN1 n/a
3 TRCN0000382151 AGGCGATTACTGCAATCTTTG pLKO_005 156 CDS 100% 10.800 15.120 N MFN1 n/a
4 TRCN0000380334 ATCCGGAACTTGATCGAATAG pLKO_005 234 CDS 100% 10.800 15.120 N MFN1 n/a
5 TRCN0000051834 GCCCTTCACATGGACAAAGAT pLKO.1 542 CDS 100% 5.625 4.500 N MFN1 n/a
6 TRCN0000310826 TAGTGGGATTGGCCATATAAC pLKO_005 415 CDS 100% 13.200 9.240 N MFN1 n/a
7 TRCN0000304141 TGTTACTGAAGGATCACATTT pLKO_005 193 CDS 100% 13.200 9.240 N MFN1 n/a
8 TRCN0000051833 GCTCCCATTATGATTCCAATA pLKO.1 2985 3UTR 100% 10.800 7.560 N MFN1 n/a
9 TRCN0000300841 GCTCCCATTATGATTCCAATA pLKO_005 2985 3UTR 100% 10.800 7.560 N MFN1 n/a
10 TRCN0000048421 GCCTTTAAACAGCAGTTTGTA pLKO.1 2030 CDS 100% 5.625 3.938 N LOC441511 n/a
11 TRCN0000051836 CCATCATTGGTGAGGTGCTAT pLKO.1 303 CDS 100% 4.950 3.465 N MFN1 n/a
12 TRCN0000051837 GCTCAAAGTTGTAAATGCTTT pLKO.1 910 CDS 100% 4.950 3.465 N MFN1 n/a
13 TRCN0000300765 GCTCAAAGTTGTAAATGCTTT pLKO_005 910 CDS 100% 4.950 3.465 N MFN1 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4948 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4948 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033540.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03626 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03626 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478631 TTTCTACTTTGAACGTAGCCTTAA pLX_317 13.9% 100% 100% V5 n/a
Download CSV