Transcript: Mouse NM_033563.2

Mus musculus Kruppel-like factor 7 (ubiquitous) (Klf7), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Klf7 (93691)
Length:
1344
CDS:
389..1294

Additional Resources:

NCBI RefSeq record:
NM_033563.2
NBCI Gene record:
Klf7 (93691)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232328 TAACGGGTGCCGGAAAGTTTA pLKO_005 1054 CDS 100% 13.200 18.480 N Klf7 n/a
2 TRCN0000013261 GTGCCGGAAAGTTTATACAAA pLKO.1 1060 CDS 100% 5.625 7.875 N KLF7 n/a
3 TRCN0000084230 CTCAACGCAGTGACCTCATTA pLKO.1 776 CDS 100% 13.200 10.560 N Klf7 n/a
4 TRCN0000232325 TCAACGCAGTGACCTCATTAA pLKO_005 777 CDS 100% 13.200 10.560 N Klf7 n/a
5 TRCN0000235752 TCAACGCAGTGACCTCATTAA pLKO_005 777 CDS 100% 13.200 10.560 N KLF7 n/a
6 TRCN0000084232 CCCATGCATTGAGGAGAGCTT pLKO.1 589 CDS 100% 2.640 2.112 N Klf7 n/a
7 TRCN0000257275 ACGGGTGCCGGAAAGTTTATA pLKO_005 1056 CDS 100% 15.000 10.500 N KLF7 n/a
8 TRCN0000232324 AGAGCTCCGCAGTGGACATTT pLKO_005 660 CDS 100% 13.200 9.240 N Klf7 n/a
9 TRCN0000232327 GACACCAGCTGGAGCAGTTAA pLKO_005 949 CDS 100% 13.200 9.240 N Klf7 n/a
10 TRCN0000232326 ATGGCACAGTGACGTTGAAAC pLKO_005 864 CDS 100% 10.800 7.560 N Klf7 n/a
11 TRCN0000084228 GATGGCACAGTGACGTTGAAA pLKO.1 863 CDS 100% 5.625 3.938 N Klf7 n/a
12 TRCN0000084229 GCAGCAGACATGCCTTGAGTT pLKO.1 484 CDS 100% 4.950 3.465 N Klf7 n/a
13 TRCN0000084231 ACAGGAAACACACAGGTGCAA pLKO.1 1194 CDS 100% 2.640 1.848 N Klf7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11283 pDONR223 100% 71.6% 56.9% None (many diffs) n/a
2 ccsbBroad304_11283 pLX_304 0% 71.6% 56.9% V5 (many diffs) n/a
3 TRCN0000469755 CCACTTGTTCCCCGACCCCATAAG pLX_317 52.5% 71.6% 56.9% V5 (many diffs) n/a
Download CSV