Transcript: Mouse NM_033602.2

Mus musculus pellino 2 (Peli2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Peli2 (93834)
Length:
5849
CDS:
289..1548

Additional Resources:

NCBI RefSeq record:
NM_033602.2
NBCI Gene record:
Peli2 (93834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033602.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216895 GAATGCCAGGACTAGCATAAA pLKO.1 4740 3UTR 100% 13.200 10.560 N Peli2 n/a
2 TRCN0000248151 GCCATACACAGCACGCATATT pLKO_005 732 CDS 100% 13.200 10.560 N Peli2 n/a
3 TRCN0000200236 CAAACCCAGCACAATCCACAT pLKO.1 450 CDS 100% 4.050 3.240 N Peli2 n/a
4 TRCN0000248148 AGCAGATTTGCCCTCTATAAG pLKO_005 409 CDS 100% 13.200 9.240 N Peli2 n/a
5 TRCN0000248152 CCAACAAGGAGCCGGTGAAAT pLKO_005 323 CDS 100% 13.200 9.240 N Peli2 n/a
6 TRCN0000248149 GCCCATTAGCAGATACTATTT pLKO_005 3104 3UTR 100% 13.200 9.240 N Peli2 n/a
7 TRCN0000248150 GTGGAGTACACACACGATAAA pLKO_005 559 CDS 100% 13.200 9.240 N Peli2 n/a
8 TRCN0000182278 GCTCCTACTCAGAAGCACATA pLKO.1 1075 CDS 100% 4.950 2.970 N Peli2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033602.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477173 GCAAGACGTCATATGTCCCCACTC pLX_317 26.5% 86.9% 95.2% V5 (many diffs) n/a
2 ccsbBroadEn_08713 pDONR223 100% 86.9% 95.2% None (many diffs) n/a
3 ccsbBroad304_08713 pLX_304 0% 86.9% 95.2% V5 (many diffs) n/a
4 ccsbBroadEn_03799 pDONR223 100% 86.9% 95.2% None (many diffs) n/a
5 ccsbBroad304_03799 pLX_304 0% 86.9% 95.2% V5 (many diffs) n/a
Download CSV