Transcript: Human NM_033655.3

Homo sapiens contactin associated protein like 3 (CNTNAP3), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
CNTNAP3 (79937)
Length:
5229
CDS:
240..4106

Additional Resources:

NCBI RefSeq record:
NM_033655.3
NBCI Gene record:
CNTNAP3 (79937)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426667 AGTGTACGGATGTGCATATAA pLKO_005 758 CDS 100% 15.000 7.500 Y CNTNAP3 n/a
2 TRCN0000418828 CAATGAGATTTCCGCATATTT pLKO_005 3230 CDS 100% 15.000 7.500 Y CNTNAP3 n/a
3 TRCN0000432823 GCAGTTTGATCTGTGTTAATA pLKO_005 4419 3UTR 100% 15.000 7.500 Y CNTNAP3 n/a
4 TRCN0000412699 GTGATAGCAGTGGTGATATTT pLKO_005 3987 CDS 100% 15.000 7.500 Y CNTNAP3 n/a
5 TRCN0000430293 ACACGAACTCCGAGCTTATTG pLKO_005 3384 CDS 100% 13.200 6.600 Y CNTNAP3 n/a
6 TRCN0000431523 CACAGTCCTCCACATCAATTT pLKO_005 4324 3UTR 100% 13.200 6.600 Y CNTNAP3 n/a
7 TRCN0000119185 CGCCGTCAAATCTCTCATATT pLKO.1 3647 CDS 100% 13.200 6.600 Y CNTNAP3 n/a
8 TRCN0000119182 GCCTGGAAACACTACCATTAT pLKO.1 4739 3UTR 100% 13.200 6.600 Y CNTNAP3 n/a
9 TRCN0000424272 GGAGTGGATGTTACCGAATTA pLKO_005 1257 CDS 100% 13.200 6.600 Y CNTNAP3 n/a
10 TRCN0000424833 TTCCAGTTACTTGGATCTTAA pLKO_005 1139 CDS 100% 13.200 6.600 Y CNTNAP3 n/a
11 TRCN0000119184 CAGATCCTCATGATGGGAAAT pLKO.1 1296 CDS 100% 10.800 5.400 Y CNTNAP3 n/a
12 TRCN0000415592 CCATAGCCATACGCATCTATC pLKO_005 4027 CDS 100% 10.800 5.400 Y CNTNAP3 n/a
13 TRCN0000119186 ACAGAGCAGGACATTTGCTTT pLKO.1 1444 CDS 100% 4.950 2.475 Y CNTNAP3 n/a
14 TRCN0000119183 CCTCTTTCTTAAGGATGGCAA pLKO.1 1499 CDS 100% 2.640 1.320 Y CNTNAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12646 pDONR223 100% 93.5% 93.5% None (many diffs) n/a
2 ccsbBroad304_12646 pLX_304 0% 93.5% 93.5% V5 (many diffs) n/a
3 TRCN0000476859 AGTTTCTCGCGGTACGTTTCCTTC pLX_317 12.5% 93.5% 93.5% V5 (many diffs) n/a
Download CSV