Transcript: Human NM_052840.5

Homo sapiens CUGBP Elav-like family member 6 (CELF6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CELF6 (60677)
Length:
3373
CDS:
284..1729

Additional Resources:

NCBI RefSeq record:
NM_052840.5
NBCI Gene record:
CELF6 (60677)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052840.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428807 AGTCCTGACGGCACCAGTAAA pLKO_005 785 CDS 100% 13.200 18.480 N CELF6 n/a
2 TRCN0000427843 CATATCATTCCTTAGAGTTTA pLKO_005 2050 3UTR 100% 13.200 18.480 N CELF6 n/a
3 TRCN0000098642 GCCAGGGATGAATCGTCCGAT pLKO.1 622 CDS 100% 0.880 1.232 N Celf6 n/a
4 TRCN0000074450 CGTCGGCATGAGCGGGCTAAA pLKO.1 361 CDS 100% 0.000 0.000 N CELF6 n/a
5 TRCN0000412680 AGACAGTATAGAGTCTCATAA pLKO_005 2170 3UTR 100% 13.200 9.240 N CELF6 n/a
6 TRCN0000074448 GCCCAGATTTACTTCTTTCAA pLKO.1 2026 3UTR 100% 5.625 3.938 N CELF6 n/a
7 TRCN0000074451 TCTGCTAAAGTCTTTGTGGAT pLKO.1 1553 CDS 100% 2.640 1.848 N CELF6 n/a
8 TRCN0000074449 CATACAGACATTCCTGCCCTT pLKO.1 1519 CDS 100% 2.160 1.512 N CELF6 n/a
9 TRCN0000074452 CCAGACTGCTATTCAGGCGAT pLKO.1 1633 CDS 100% 2.160 1.512 N CELF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052840.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15129 pDONR223 86.6% 75.1% 72.4% None (many diffs) n/a
2 ccsbBroad304_15129 pLX_304 0% 75.1% 72.4% V5 (many diffs) n/a
3 TRCN0000465220 ATAAAGCACCCGCTCCGACAGGGA pLX_317 17.5% 75.1% 72.4% V5 (many diffs) n/a
Download CSV