Transcript: Human NM_052843.4

Homo sapiens obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (OBSCN), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
OBSCN (84033)
Length:
20518
CDS:
161..20023

Additional Resources:

NCBI RefSeq record:
NM_052843.4
NBCI Gene record:
OBSCN (84033)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147726 CAGCTCGAAAGTGCGCATGG pXPR_003 AGG 4468 22% 15 0.6946 OBSCN OBSCN 76115
2 BRDN0001145479 TGCCGGGGAGTATAGCTGCG pXPR_003 AGG 2884 15% 9 0.3713 OBSCN OBSCN 76114
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_052843.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021600 CCCAGATTATACTGGTTCAAA pLKO.1 16028 CDS 100% 5.625 7.875 N OBSCN n/a
2 TRCN0000021602 GCAGGAGAGATCCAATTTGTA pLKO.1 6959 CDS 100% 5.625 7.875 N OBSCN n/a
3 TRCN0000199810 GCCAGAGGATAGTGGCCTTAT pLKO.1 6577 CDS 100% 10.800 8.640 N OBSCN n/a
4 TRCN0000200011 CGGAGGTGATGTGGTACAAAG pLKO.1 3192 CDS 100% 10.800 7.560 N OBSCN n/a
5 TRCN0000195337 CCGCGAAGATGAGCATTTCAT pLKO.1 15313 CDS 100% 5.625 3.938 N OBSCN n/a
6 TRCN0000195565 CCTGTCATCAGCTGGTACAAA pLKO.1 18287 CDS 100% 5.625 3.938 N OBSCN n/a
7 TRCN0000021601 CCTGCCAGATTCATAGAAGAT pLKO.1 11561 CDS 100% 4.950 3.465 N OBSCN n/a
8 TRCN0000021603 CCTGCCAGGTTCATAGAAGAT pLKO.1 10769 CDS 100% 4.950 3.465 N OBSCN n/a
9 TRCN0000021599 CCTTCTTACCTCACTCAACTT pLKO.1 20149 3UTR 100% 4.950 3.465 N OBSCN n/a
10 TRCN0000199121 CTCAGGACTGTGGACGAAGGA pLKO.1 20261 3UTR 100% 0.880 0.616 N OBSCN n/a
11 TRCN0000162384 CAGTGGTACAAGGATGACAAA pLKO.1 7658 CDS 100% 4.950 2.475 Y NTM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_052843.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12766 pDONR223 100% 2% 1.5% None (many diffs) n/a
2 ccsbBroad304_12766 pLX_304 0% 2% 1.5% V5 (many diffs) n/a
3 TRCN0000471157 GGAGTAGAAGCTGCTTGCCGATTC pLX_317 87.1% 2% 1.5% V5 (many diffs) n/a
Download CSV