Transcript: Human NM_053032.4

Homo sapiens myosin light chain kinase (MYLK), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
MYLK (4638)
Length:
4775
CDS:
255..719

Additional Resources:

NCBI RefSeq record:
NM_053032.4
NBCI Gene record:
MYLK (4638)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_053032.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000936 ACTGTCCTCTATGGCAATGAT pLKO.1 245 5UTR 100% 5.625 7.875 N MYLK n/a
2 TRCN0000000935 GACGGGAACTGCTCTTTAATT pLKO.1 558 CDS 100% 15.000 10.500 N MYLK n/a
3 TRCN0000195567 CCACAGTATTGCCACAGTTTA pLKO.1 2244 3UTR 100% 13.200 9.240 N MYLK n/a
4 TRCN0000342488 CCACAGTATTGCCACAGTTTA pLKO_005 2244 3UTR 100% 13.200 9.240 N MYLK n/a
5 TRCN0000199504 GCACTCAGACTTGCGTCTTTA pLKO.1 1840 3UTR 100% 13.200 9.240 N MYLK n/a
6 TRCN0000195592 CCTACCTTATGGGTTCCATAT pLKO.1 1749 3UTR 100% 10.800 7.560 N MYLK n/a
7 TRCN0000220705 GCTAGATTTGACTGCAAGATT pLKO.1 450 CDS 100% 5.625 3.938 N Mylk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053032.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489873 TTTACCTCCTTTTCCTACACCTGC pLX_317 12.6% 13.9% 13.9% V5 (not translated due to prior stop codon) 0_1ins2850 n/a
2 TRCN0000491341 TTCTTAAGACCGAAAAATAGATTC pLX_317 10.1% 13.9% 13.9% V5 0_1ins2853;462_463insG n/a
Download CSV