Transcript: Human NM_053053.4

Homo sapiens transcriptional adaptor 1 (TADA1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TADA1 (117143)
Length:
2096
CDS:
32..1039

Additional Resources:

NCBI RefSeq record:
NM_053053.4
NBCI Gene record:
TADA1 (117143)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_053053.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244039 GGCAGTTTCTTCGGTTAATTA pLKO_005 1750 3UTR 100% 15.000 21.000 N TADA1 n/a
2 TRCN0000244038 ACGAAACTCTGGCATCCAAAT pLKO_005 947 CDS 100% 10.800 15.120 N TADA1 n/a
3 TRCN0000244037 GCTGTGGAGAATCACCTTAAA pLKO_005 563 CDS 100% 13.200 9.240 N TADA1 n/a
4 TRCN0000244036 TCGGTTACGAGATGGTCATTT pLKO_005 622 CDS 100% 13.200 9.240 N TADA1 n/a
5 TRCN0000244035 ACAATACTGGGCTAACCTAAA pLKO_005 103 CDS 100% 10.800 7.560 N TADA1 n/a
6 TRCN0000167798 GAAGAATAGTGTAGTAGCTTA pLKO.1 685 CDS 100% 4.950 3.465 N TADA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053053.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04720 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04720 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472848 GGGAGTGAGAAAGGGTCCACACCA pLX_317 37.1% 100% 100% V5 n/a
Download CSV